ORK00972

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00972

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00972
Clone name	ah00257
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	IRS1
cDNA sequence	DNA sequence (5660 bp) Predicted protein sequence (1316 aa)
HaloTag ORF Clone	FHC00972
Flexi ORF Clone	FXC00972
Description	Insulin receptor substrate 1 (IRS-1).

Features of the cloned cDNA sequence

Description

Length: 5660 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1058 bp
Genome contig ID	gi89161199r_227208174
PolyA signal sequence (AATAAA,-34)	+--------+--------+----*----+---- TAATAAACTAGATACTGTTGATCTTTTCTTCTGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CCCTCCCCCCACCACTTCTGTAAGTTTCCTGCTCTATTCCCACCATTTTT

Features of the protein sequence

Description

Length: 1316 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P35568	100.0	Insulin recepto...	Homo sapiens
ACE87211	99.9	insulin recepto...	synthetic construct
AAB21608	99.7	hIRS-1 [Homo sa...	Homo sapiens
XP_001134895	99.1	insulin recepto...	Pan troglodytes
AAT99886	92.1	insulin recepto...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002404	233	252	PR00628	Insulin receptor substrate-1
	IPR002404	254	274	PR00628	Insulin receptor substrate-1
	IPR002404	276	292	PR00628	Insulin receptor substrate-1
	IPR002404	293	305	PR00628	Insulin receptor substrate-1
	IPR002404	306	314	PR00628	Insulin receptor substrate-1
	IPR002404	317	341	PR00628	Insulin receptor substrate-1
HMMPfam	IPR001849	87	189	PF00169	Pleckstrin-like
HMMPfam	IPR002404	234	336	PF02174	Insulin receptor substrate-1
HMMSmart	IPR001849	87	191	SM00233	Pleckstrin-like
HMMSmart	IPR002404	234	336	SM00310	Insulin receptor substrate-1
ProfileScan	IPR001849	86	189	PS50003	Pleckstrin-like
ProfileScan	IPR002404	234	338	PS51064	Insulin receptor substrate-1

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp