ORK00973

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00973

Order Kazusa clone(s) from :

Accession No	AB209990
Product ID	ORK00973
Clone name	ah00907
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PDE7B
cDNA sequence	DNA sequence (5493 bp) Predicted protein sequence (586 aa)
HaloTag ORF Clone	FHC00973
Flexi ORF Clone	FXC00973
Description	cAMP-specific 3',5'-cyclic phosphodiesterase 7B (EC 3.1.4.17).

Features of the cloned cDNA sequence

Description

Length: 5493 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3731 bp
Genome contig ID	gi89161210f_136300869
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AACAAATAAAAATAAAGATAATTTCTTTAAAATAT
Flanking genome sequence (257536 - 257585)	----+--------+--------+--------+--------+----* CACAAGATGAAAATATCCTAATTCTCACCAGGTAACATGTTACCAGTCAA

Features of the protein sequence

Description

Length: 586 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE06072	0	100.0	PDE7B variant p...	Homo sapiens
XP_001157383	0	98.8	phosphodiestera...	Pan troglodytes
ABL14249	4.8e-200	100.0	phosphodiestera...	Homo sapiens
XP_001100632	4e-196	97.8	phosphodiestera...	Macaca mulatta
XP_001503586	3.2e-184	85.6	similar to PDE7...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002073	304	317	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	335	348	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	349	364	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	376	392	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	455	468	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	472	488	PR00387	3'5'-cyclic nucleotide phosphodiesterase
HMMPfam	IPR002073	308	546	PF00233	3'5'-cyclic nucleotide phosphodiesterase
HMMSmart	IPR003607	306	473	SM00471	Metal-dependent phosphohydrolase
ScanRegExp	IPR002073	349	360	PS00126	3'5'-cyclic nucleotide phosphodiesterase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp