ORK00975

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00975

Order Kazusa clone(s) from :

Accession No	AB209991
Product ID	ORK00975
Clone name	aj01345
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	BCR
cDNA sequence	DNA sequence (4594 bp) Predicted protein sequence (1287 aa)
HaloTag ORF Clone	FHC00975
Flexi ORF Clone	FXC00975
Description	Breakpoint cluster region protein (EC 2.7.11.1) (Renal carcinoma antigen NY-REN-26).

Features of the cloned cDNA sequence

Description

Length: 4594 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	433 bp
Genome contig ID	gi89161203f_21752806
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GTTGTATCTTGAATAAACGCTGCTGCTTCATCCTG
Flanking genome sequence (235338 - 235387)	----+--------+--------+--------+--------+----* TGGGGGCCGTGGCCCTGTCCCTGTGTGGGTGGGGCCTCTTCCATTTCCCT

Features of the protein sequence

Description

Length: 1287 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06073	100.0	BCR variant pro...	Homo sapiens
BAG10210	100.0	breakpoint clus...	synthetic construct
P11274	99.9	Breakpoint clus...	Homo sapiens
CAA26441	99.9	bcr [Homo sapiens].	Homo sapiens
NP_001074881	93.8	breakpoint clus...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015123	17	95	PF09036	Bcr-Abl oncoprotein oligomerisation
	IPR000219	518	706	PF00621	DH
	IPR000008	929	1018	PF00168	C2 calcium-dependent membrane targeting
	IPR000198	1084	1237	PF00620	RhoGAP
HMMSmart	IPR000219	518	706	SM00325	DH
	IPR001849	725	884	SM00233	Pleckstrin-like
	IPR000008	928	1033	SM00239	C2 calcium-dependent membrane targeting
	IPR000198	1081	1265	SM00324	RhoGAP
ProfileScan	IPR000219	514	707	PS50010	DH
	IPR001849	724	882	PS50003	Pleckstrin-like
	IPR000008	886	1018	PS50004	C2 calcium-dependent membrane targeting
	IPR000198	1070	1264	PS50238	RhoGAP
ScanRegExp	IPR001331	655	680	PS00741	Guanine-nucleotide dissociation stimulator

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp