Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00977
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00977
Clone name bm00447
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ARHGEF25
cDNA sequence DNA sequence (2245 bp)
Predicted protein sequence (631 aa)
Flexi ORF Clone FXC00977
Description RAC/CDC42/Rho exchange factor
Features of the cloned cDNA sequence

Length: 2245 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 348 bp
Genome contig ID gi89161190f_56190230
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTCCTGTTTTCTGAGAATAAAGGTTTTGTTATATC
Flanking genome sequence
(107064 - 107113)
----+----*----+----*----+----*----+----*----+----*
ACCGAGGCTGCTGTCTTGGCAGAGGGAAGGGGAGGCTGTAGTGGGGGTAG

Features of the protein sequence

Length: 631 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAF94999 0 100.0 RAC/CDC42/Rho e...
Homo sapiens
NP_891992 1.3e-201 100.0 guanine nucleot...
Homo sapiens
ABM46721 2.7e-201 100.0 SLC26A10 [Goril...
Gorilla gorilla
Q86VW2 2.8e-201 99.8 Guanine nucleot...
Homo sapiens
AAO49463 4.4e-200 99.6 RAC/CDC42/Rho e...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000219 215 386 PF00621 DH
HMMSmart IPR000219 215 386 SM00325 DH
ProfileScan IPR000219 211 387 PS50010 DH
IPR001849 399 517 PS50003 Pleckstrin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp