ORK00982

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00982

Order Kazusa clone(s) from :

Accession No	AB210009
Product ID	ORK00982
Clone name	fh00134
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PPFIA2
cDNA sequence	DNA sequence (5405 bp) Predicted protein sequence (1258 aa)
HaloTag ORF Clone	FHC00982
Flexi ORF Clone	FXC00982
Description	Liprin-alpha-2 (Protein tyrosine phosphatase receptor type f polypeptide-interacting protein alpha-2) (PTPRF-interacting protein alpha-2).

Features of the cloned cDNA sequence

Description

Length: 5405 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1365 bp
Genome contig ID	gi89161190r_80076195
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CCCTTTCCATTGTCAATAAAAAAAATAATAATTCC
Flanking genome sequence (99982 - 99933)	----+--------+--------+--------+--------+----* AGTTCTCTGTTTAAGCTTTGTTTTCTAGTCACATAAGGCTCGACAATTTA

Features of the protein sequence

Description

Length: 1258 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06091	100.0	PPFIA2 variant ...	Homo sapiens
BAG10219	100.0	liprin-alpha-2 ...	synthetic construct
XP_001088353	99.8	similar to PTPR...	Macaca mulatta
NP_003616	100.0	liprin-alpha-2 ...	Homo sapiens
O75334	99.6	Liprin-alpha-2;...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	907	973	PF00536	Sterile alpha motif SAM
	IPR001660	1029	1093	PF00536	Sterile alpha motif SAM
	IPR011510	1116	1188	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001660	906	975	SM00454	Sterile alpha motif SAM
	IPR001660	1028	1095	SM00454	Sterile alpha motif SAM
	IPR001660	1116	1188	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	909	975	PS50105	Sterile alpha motif SAM
	IPR001660	1038	1095	PS50105	Sterile alpha motif SAM
	IPR001660	1119	1188	PS50105	Sterile alpha motif SAM

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp