ORK00987

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00987

Order Kazusa clone(s) from :

Accession No	AB210013
Product ID	ORK00987
Clone name	fh17714
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EIF4G1
cDNA sequence	DNA sequence (5653 bp) Predicted protein sequence (1624 aa)
HaloTag ORF Clone	FHC00987
Flexi ORF Clone	FXC00987
Description	Eukaryotic translation initiation factor 4 gamma 1 (eIF-4-gamma 1) (eIF-4G1) (eIF-4G 1) (p220).

Features of the cloned cDNA sequence

Description

Length: 5653 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	443 bp
Genome contig ID	gi89161205f_185415890
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- CACGGTGCCTGTAATTATTAAACATGAATTCAATT
Flanking genome sequence (119945 - 119994)	----+--------+--------+--------+--------+----* AAGCTCACTGCCTTTCTGCTTTATGCCCTGCTCCCTCTAGAGAAGGTGTT

Features of the protein sequence

Description

Length: 1624 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06095	100.0	EIF4G1 variant ...	Homo sapiens
BAG10224	100.0	eukaryotic tran...	synthetic construct
AAI40897	99.9	EIF4G1 protein ...	Homo sapiens
XP_001146388	99.7	eukaryotic tran...	Pan troglodytes
NP_886553	99.5	eukaryotic tran...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003890	786	1014	PF02854	MIF4G-like
	IPR003891	1267	1379	PF02847	Initiation factor eIF-4 gamma
	IPR003307	1543	1624	PF02020	eIF4-gamma/eIF5/eIF2-epsilon
HMMSmart	IPR003890	786	1014	SM00543	MIF4G-like
	IPR003891	1267	1379	SM00544	Initiation factor eIF-4 gamma
	IPR003307	1533	1620	SM00515	eIF4-gamma/eIF5/eIF2-epsilon

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp