ORK00988

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00988

Order Kazusa clone(s) from :

Accession No	AB210014
Product ID	ORK00988
Clone name	fj01677
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	STAU2
cDNA sequence	DNA sequence (4044 bp) Predicted protein sequence (490 aa)
HaloTag ORF Clone	FHC00988
Flexi ORF Clone	FXC00988
Description	Double-stranded RNA-binding protein Staufen homolog 2.

Features of the cloned cDNA sequence

Description

Length: 4044 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2402 bp
Genome contig ID	gi51511724r_74524393
PolyA signal sequence (AGTAAA,-28)	+--------+--------+----*----+---- ATTACAAAGTAAAAATATATGAGTGTATTGAAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGTTGTTTTAACTTTTAATTTTGTTTCATCACCCAGTCTTTAATTTGA

Features of the protein sequence

Description

Length: 490 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE06096	5.9e-193	100.0	STAU2 variant p...	Homo sapiens
BAG10225	8.5e-188	100.0	double-stranded...	synthetic construct
CAB64341	1.5e-187	99.7	39k3 protein [H...	Homo sapiens
CAH91481	1.7e-187	99.5	hypothetical pr...	Pongo abelii
AAN37927	3.4e-187	99.7	double-stranded...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001159	103	158	PF00035	Double-stranded RNA binding
	IPR001159	187	251	PF00035	Double-stranded RNA binding
	IPR001159	287	352	PF00035	Double-stranded RNA binding
HMMSmart	IPR001159	75	159	SM00358	Double-stranded RNA binding
	IPR001159	187	252	SM00358	Double-stranded RNA binding
	IPR001159	287	353	SM00358	Double-stranded RNA binding
ProfileScan	IPR001159	74	160	PS50137	Double-stranded RNA binding
	IPR001159	186	253	PS50137	Double-stranded RNA binding
	IPR001159	286	354	PS50137	Double-stranded RNA binding

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp