ORK00989

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00989

Order Kazusa clone(s) from :

Accession No	AB210015
Product ID	ORK00989
Clone name	fj03007
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MYO1C
cDNA sequence	DNA sequence (4257 bp) Predicted protein sequence (1097 aa)
HaloTag ORF Clone	FHC00989
Flexi ORF Clone	FXC00989
Description	Myosin-Ic (Myosin I beta) (MMI-beta) (MMIb).

Features of the cloned cDNA sequence

Description

Length: 4257 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	895 bp
Genome contig ID	gi51511734r_1215156
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCAACAGAGCGAGACTCCGTCTT
Flanking genome sequence (99719 - 99670)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGAACGCCCTTTTACTGTCCTCATCATCCCAGTTTG

Features of the protein sequence

Description

Length: 1097 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06097	100.0	MYO1C variant p...	Homo sapiens
BAG10226	100.0	myosin-Ic [synt...	synthetic construct
NP_001074248	99.8	myosin-Ic isofo...	Homo sapiens
XP_001504349	97.6	similar to MYO1...	Equus caballus
CAI24088	96.8	myosin IC [Mus ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	206	235	PD000355	Myosin head
FPrintScan	IPR001609	111	130	PR00193	Myosin head
	IPR001609	167	192	PR00193	Myosin head
	IPR001609	213	240	PR00193	Myosin head
	IPR001609	450	478	PR00193	Myosin head
	IPR001609	503	531	PR00193	Myosin head
HMMPfam	IPR001609	82	752	PF00063	Myosin head
	IPR000048	769	789	PF00612	IQ calmodulin-binding region
	IPR000048	792	812	PF00612	IQ calmodulin-binding region
	IPR010926	907	1093	PF06017	Myosin tail 2
HMMSmart	IPR001609	74	766	SM00242	Myosin head
	IPR000048	767	789	SM00015	IQ calmodulin-binding region
	IPR000048	790	812	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	768	794	PS50096	IQ calmodulin-binding region
ProfileScan	IPR000048	792	820	PS50096	IQ calmodulin-binding region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp