ORK00991

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00991

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00991
Clone name	fj11242
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZCCHC8
cDNA sequence	DNA sequence (4832 bp) Predicted protein sequence (486 aa)
HaloTag ORF Clone	FHC00991
Flexi ORF Clone	FXC00991
Description	Zinc finger CCHC domain-containing protein 8.

Features of the cloned cDNA sequence

Description

Length: 4832 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	602 bp
Genome contig ID	gi89161190r_121423395
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GTACAGAGGTTTAATAAATTAGTTTTCATACACAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCTAAGACTTTGAATACAAAAAAGTGATTCACAGGTAAAATCAGTGTA

Features of the protein sequence

Description

Length: 486 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH17704	1.9e-146	100.0	ZCCHC8 protein ...	Homo sapiens
EAW98325	2.4e-146	100.0	zinc finger, CC...	Homo sapiens
Q6NZY4	2.5e-146	100.0	Zinc finger CCH...	Homo sapiens
BAB55308	4.2e-146	99.7	unnamed protein...	Homo sapiens
AAH65918	4.2e-146	99.7	Zinc finger, CC...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001878	6	23	PF00098	Zinc finger
HMMPfam	IPR006568	66	114	PF04046	PSP
HMMSmart	IPR001878	7	23	SM00343	Zinc finger
HMMSmart	IPR006568	62	114	SM00581	PSP
ProfileScan	IPR001878	8	22	PS50158	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp