Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00992
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB210017
Product ID ORK00992
Clone name fj13355
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PICALM
cDNA sequence DNA sequence (3613 bp)
Predicted protein sequence (721 aa)
Flexi ORF Clone FXC00992
Description Phosphatidylinositol-binding clathrin assembly protein (Clathrin assembly lymphoid myeloid leukemia protein).
Features of the cloned cDNA sequence

Length: 3613 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1358 bp
Genome contig ID gi51511727r_85246379
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AATGGGTGGATTTTCAAATAAAATGCAGCTTCCAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAGTTTTGTTATGGTATTCTGGTCTGAGATGCATTTTCATTTTTCCTT

Features of the protein sequence

Length: 721 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06099 0 100.0 PICALM variant ...
Homo sapiens
XP_508908 0 99.8 phosphatidylino...
Pan troglodytes
EDL06760 0 96.1 phosphatidylino...
Mus musculus
BAG10229 0 100.0 phosphatidylino...
synthetic construct
Q13492 0 98.9 Phosphatidylino...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR011417 95 361 PF07651 ANTH
HMMSmart IPR013809 96 221 SM00273 Epsin-like
ProfileScan IPR013809 90 221 PS50942 Epsin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp