ORK00994

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00994

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00994
Clone name	fk02504
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	LINGO1
cDNA sequence	DNA sequence (2994 bp) Predicted protein sequence (658 aa)
HaloTag ORF Clone	FHC00994
Flexi ORF Clone	FXC00994
Description	leucine-rich repeat neuronal 6A

Features of the cloned cDNA sequence

Description

Length: 2994 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1017 bp
Genome contig ID	gi51511731r_75592674
PolyA signal sequence (None)	+--------+--------+----*----+---- ACACTTTGTAACCTGTAAAGCGCTGTGCACACGTG
Flanking genome sequence (99750 - 99701)	----+--------+--------+--------+--------+----* TGGGTGACTGTTCTCATTATGGTCATTATTATCTCACTGTGGGGGATGGG

Features of the protein sequence

Description

Length: 658 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96FE5	100.0	Leucine-rich re...	Homo sapiens
XP_001105006	95.4	similar to leuc...	Macaca mulatta
XP_598942	99.5	similar to leuc...	Bos taurus
AAQ88651	99.6	QVSK201 [Homo s...	Homo sapiens
XP_001929222	99.1	leucine rich re...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	183	196	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	372	385	PR00019	Leucine-rich repeat
HMMPfam	IPR000372	79	108	PF01462	Leucine-rich repeat
	IPR001611	134	156	PF00560	Leucine-rich repeat
	IPR001611	158	180	PF00560	Leucine-rich repeat
	IPR001611	182	204	PF00560	Leucine-rich repeat
	IPR001611	206	228	PF00560	Leucine-rich repeat
	IPR001611	230	252	PF00560	Leucine-rich repeat
	IPR001611	302	324	PF00560	Leucine-rich repeat
	IPR001611	326	348	PF00560	Leucine-rich repeat
	IPR001611	374	396	PF00560	Leucine-rich repeat
	IPR013098	462	552	PF07679	Immunoglobulin I-set
HMMSmart	IPR000372	79	113	SM00013	Leucine-rich repeat
	IPR003591	132	155	SM00369	Leucine-rich repeat
	IPR003591	156	179	SM00369	Leucine-rich repeat
	IPR003591	180	203	SM00369	Leucine-rich repeat
	IPR003591	204	227	SM00369	Leucine-rich repeat
	IPR003591	228	251	SM00369	Leucine-rich repeat
	IPR003591	252	275	SM00369	Leucine-rich repeat
	IPR003591	324	347	SM00369	Leucine-rich repeat
	IPR003591	348	371	SM00369	Leucine-rich repeat
	IPR003591	372	395	SM00369	Leucine-rich repeat
	IPR003599	469	553	SM00409	Immunoglobulin subtype
	IPR003598	475	542	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	449	551	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	57	LLACWQPILLLVLGSVLSGSATG	79	PRIMARY	23
SOSUI2	2	596	IIATTMGFISFLGVVLFCLVLLF	618	PRIMARY	23