Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00996
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00996
Clone name fk13090
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SYTL4
cDNA sequence DNA sequence (3608 bp)
Predicted protein sequence (672 aa)
Flexi ORF Clone FXC00996
Description Synaptotagmin-like protein 4 (Exophilin-2) (Granuphilin).
Features of the cloned cDNA sequence

Length: 3608 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1536 bp
Genome contig ID gi89161218r_99716147
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGTATGTGTGCTTTAATAAAGCTTTCTCACTTGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACGTTTGTGTTTGTTAGTTCTATAAATGCTTTTGTCTCTGATGTCCTC

Features of the protein sequence

Length: 672 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96C24 0 100.0 Synaptotagmin-l...
Homo sapiens
CAI41007 0 99.8 synaptotagmin-l...
Homo sapiens
BAF85277 0 99.8 unnamed protein...
Homo sapiens
BAG35911 0 99.8 unnamed protein...
Homo sapiens
BAC04287 0 99.7 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001565 361 376 PR00399 Synaptotagmin
IPR001565 376 389 PR00399 Synaptotagmin
IPR001565 434 449 PR00399 Synaptotagmin
IPR001565 454 464 PR00399 Synaptotagmin
IPR000008 544 556 PR00360 C2 calcium-dependent membrane targeting
IPR000008 573 586 PR00360 C2 calcium-dependent membrane targeting
IPR000008 598 606 PR00360 C2 calcium-dependent membrane targeting
HMMPfam IPR003315 1 220 PF02318 Rabphilin-3A effector
IPR000008 374 463 PF00168 C2 calcium-dependent membrane targeting
IPR000008 529 618 PF00168 C2 calcium-dependent membrane targeting
HMMSmart IPR000008 373 478 SM00239 C2 calcium-dependent membrane targeting
IPR000008 528 633 SM00239 C2 calcium-dependent membrane targeting
ProfileScan IPR010911 5 123 PS50916 Rab-binding
IPR000008 373 463 PS50004 C2 calcium-dependent membrane targeting
IPR000008 528 618 PS50004 C2 calcium-dependent membrane targeting
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp