ORK00998

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00998

Order Kazusa clone(s) from :

Accession No	AB210025
Product ID	ORK00998
Clone name	ha04849
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	TP53BP1
cDNA sequence	DNA sequence (6179 bp) Predicted protein sequence (1984 aa)
HaloTag ORF Clone	FHC00998
Flexi ORF Clone	FXC00998
Description	Tumor suppressor p53-binding protein 1 (p53-binding protein 1) (p53BP1) (53BP1).

Features of the cloned cDNA sequence

Description

Length: 6179 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	167 bp
Genome contig ID	gi51511731r_41386706
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TGATAAAATAAATGTTGAATCTCTTTGGTTGTAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTGGGATTTCTTCATCTGTTTTTTTGAGCTTAATCTCAGAACAAATGA

Features of the protein sequence

Description

Length: 1984 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06107	100.0	TP53BP1 variant...	Homo sapiens
BAG10235	100.0	tumor protein p...	synthetic construct
EAW92604	99.8	tumor protein p...	Homo sapiens
Q12888	99.8	Tumor suppresso...	Homo sapiens
AAW69392	99.7	tumor protein p...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015125	1497	1618	PF09038	Tumour suppressor p53-binding protein-1 Tudor
	IPR001357	1807	1847	PF00533	BRCT
	IPR001357	1876	1963	PF00533	BRCT
HMMSmart	IPR001357	1675	1850	SM00292	BRCT
HMMSmart	IPR001357	1878	1966	SM00292	BRCT
ProfileScan	IPR001357	1736	1860	PS50172	BRCT
ProfileScan	IPR001357	1876	1976	PS50172	BRCT

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp