ORK01003

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01003

Order Kazusa clone(s) from :

Accession No	AB210036
Product ID	ORK01003
Clone name	hk04261
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ITGA7
cDNA sequence	DNA sequence (4090 bp) Predicted protein sequence (1200 aa)
HaloTag ORF Clone	FHC01003
Flexi ORF Clone	FXC01003
Description	Integrin alpha-7 precursor [Contains: Integrin alpha-7 heavy chain; Integrin alpha-7 light chain].

Features of the cloned cDNA sequence

Description

Length: 4090 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	486 bp
Genome contig ID	gi89161190r_54264623
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TGGTTTCGTCTATTTATTAAAAAATATTTGAGAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACCTCTGCCTCTTTGAGTCTTGCTCTGGCATCCCCAGCATCTCTGAT

Features of the protein sequence

Description

Length: 1200 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06118	100.0	ITGA7 variant p...	Homo sapiens
EAW96821	100.0	integrin, alpha...	Homo sapiens
AAC39708	99.9	integrin alpha-...	Homo sapiens
AAC18968	99.7	integrin alpha ...	Homo sapiens
AAH50280	99.4	Integrin, alpha...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000413	323	335	PR01185	Integrins alpha chain
	IPR000413	343	354	PR01185	Integrins alpha chain
	IPR000413	376	396	PR01185	Integrins alpha chain
	IPR000413	443	467	PR01185	Integrins alpha chain
	IPR000413	502	523	PR01185	Integrins alpha chain
	IPR000413	528	547	PR01185	Integrins alpha chain
	IPR000413	647	660	PR01185	Integrins alpha chain
	IPR000413	1111	1130	PR01185	Integrins alpha chain
HMMPfam	IPR013517	383	421	PF01839	FG-GAP
	IPR013517	445	477	PF01839	FG-GAP
	IPR013517	502	532	PF01839	FG-GAP
	IPR013649	534	1025	PF08441	Integrin alpha-2
	IPR013513	1124	1138	PF00357	Integrin alpha chain
HMMSmart	IPR013519	111	173	SM00191	Integrin alpha beta-propellor
	IPR013519	322	375	SM00191	Integrin alpha beta-propellor
	IPR013519	379	435	SM00191	Integrin alpha beta-propellor
	IPR013519	440	493	SM00191	Integrin alpha beta-propellor
	IPR013519	498	554	SM00191	Integrin alpha beta-propellor
ScanRegExp	IPR013513	1123	1130	PS00242	Integrin alpha chain

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1075	MLRDASTVIPVMVYLDPMAVVAE	1097	SECONDARY	23
SOSUI2	2	1104	ILLAVLAGLLVLALLVLLLWKMG	1126	PRIMARY	23