ORK01008

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01008

Order Kazusa clone(s) from :

Accession No	AB210045
Product ID	ORK01008
Clone name	ph00435
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone ph00435 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	KIF5A
cDNA sequence	DNA sequence (5584 bp) Predicted protein sequence (1043 aa)
HaloTag ORF Clone	FHC01008
Flexi ORF Clone	FXC01008
Description	Kinesin heavy chain isoform 5A (Neuronal kinesin heavy chain) (NKHC) (Kinesin heavy chain neuron-specific 1).

Features of the cloned cDNA sequence

Description

Length: 5584 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2452 bp
Genome contig ID	gi89161190f_56130289
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TAACTTTAAAATAAAATAAATTCAATGATAACTCT
Flanking genome sequence (136395 - 136444)	----+--------+--------+--------+--------+----* ATGTTGTTGTAAATATTCTTTATCCCTTCCCAATCTCACTGCCTTCTTTG

Features of the protein sequence

Description

Length: 1043 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06127	100.0	KIF5A variant p...	Homo sapiens
BAG06728	100.0	KIF5A variant p...	Homo sapiens
Q12840	99.9	Kinesin heavy c...	Homo sapiens
BAG37640	99.8	unnamed protein...	Homo sapiens
AAA20231	99.8	neuronal kinesi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	88	109	PR00380	Kinesin
	IPR001752	207	224	PR00380	Kinesin
	IPR001752	238	256	PR00380	Kinesin
	IPR001752	288	309	PR00380	Kinesin
HMMPfam	IPR001752	26	339	PF00225	Kinesin
HMMSmart	IPR001752	18	346	SM00129	Kinesin
ProfileScan	IPR001752	17	268	PS50067	Kinesin
ScanRegExp	IPR001752	237	248	PS00411	Kinesin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp