ORK01010

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01010

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01010
Clone name	fh11574
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCDH9
cDNA sequence	DNA sequence (5774 bp) Predicted protein sequence (1213 aa)
HaloTag ORF Clone	FHC01010
Flexi ORF Clone	FXC01010
Description	Protocadherin-9 precursor.

Features of the cloned cDNA sequence

Description

Length: 5774 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1824 bp
Genome contig ID	gi51511729r_65674966
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTCAGCTCTTGCAATAAATGTTCTGAATTCCTGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCAGTGTGTTAATTCTTAGTCAACATCCAAATTGGTTATTTATACTTCT

Features of the protein sequence

Description

Length: 1213 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HC56	100.0	Protocadherin-9...	Homo sapiens
XP_001139410	99.7	protocadherin 9...	Pan troglodytes
CAD97664	99.8	hypothetical pr...	Homo sapiens
XP_869314	99.4	similar to prot...	Bos taurus
EDM02402	98.9	rCG37049, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	311	330	PR00205	Cadherin
	IPR002126	479	508	PR00205	Cadherin
	IPR002126	547	559	PR00205	Cadherin
	IPR002126	561	580	PR00205	Cadherin
	IPR002126	580	593	PR00205	Cadherin
	IPR002126	633	659	PR00205	Cadherin
	IPR002126	667	684	PR00205	Cadherin
HMMPfam	IPR013164	34	129	PF08266	Cadherin
	IPR002126	157	253	PF00028	Cadherin
	IPR002126	267	359	PF00028	Cadherin
	IPR002126	379	470	PF00028	Cadherin
	IPR002126	484	573	PF00028	Cadherin
	IPR002126	587	676	PF00028	Cadherin
	IPR002126	703	747	PF00028	Cadherin
	IPR013585	787	1012	PF08374	Protocadherin
HMMSmart	IPR002126	59	150	SM00112	Cadherin
	IPR002126	174	260	SM00112	Cadherin
	IPR002126	284	366	SM00112	Cadherin
	IPR002126	396	477	SM00112	Cadherin
	IPR002126	501	580	SM00112	Cadherin
	IPR002126	604	683	SM00112	Cadherin
	IPR002126	710	792	SM00112	Cadherin
ProfileScan	IPR002126	43	152	PS50268	Cadherin
	IPR002126	153	262	PS50268	Cadherin
	IPR002126	263	368	PS50268	Cadherin
	IPR002126	375	479	PS50268	Cadherin
	IPR002126	480	582	PS50268	Cadherin
	IPR002126	583	685	PS50268	Cadherin
	IPR002126	697	794	PS50268	Cadherin
ScanRegExp	IPR002126	140	150	PS00232	Cadherin
	IPR002126	250	260	PS00232	Cadherin
	IPR002126	356	366	PS00232	Cadherin
	IPR002126	467	477	PS00232	Cadherin
	IPR002126	570	580	PS00232	Cadherin
	IPR002126	673	683	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	18	LLAALIACLRLDSAIAQELIYTI	40	SECONDARY	23
SOSUI2	2	825	IMIAIIAGAMVVIVVIFVTVLVR	847	PRIMARY	23