ORK01011

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01011

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01011
Clone name	fh13184
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	L1CAM
cDNA sequence	DNA sequence (5093 bp) Predicted protein sequence (1271 aa)
HaloTag ORF Clone	FHC01011
Flexi ORF Clone	FXC01011
Description	Neural cell adhesion molecule L1 precursor (N-CAM L1) (CD171 antigen).

Features of the cloned cDNA sequence

Description

Length: 5093 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1145 bp
Genome contig ID	gi89161218r_152680167
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TCAGAATTATAACAGGCAAATAAAACCTGAAAATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAGCACCTTTTGTTATTTCGCGGAACACTTACTTCCCCTGTCCACGTC

Features of the protein sequence

Description

Length: 1271 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P32004	100.0	Neural cell adh...	Homo sapiens
BAF82443	99.9	unnamed protein...	Homo sapiens
BAC81122	100.0	L1 cell adhesio...	Homo sapiens
BAC81123	99.7	L1 cell adhesio...	Pan troglodytes
XP_001139376	99.6	similar to L1 c...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013151	64	130	PF00047	Immunoglobulin
	IPR013098	256	343	PF07679	Immunoglobulin I-set
	IPR013098	347	435	PF07679	Immunoglobulin I-set
	IPR013151	455	513	PF00047	Immunoglobulin
	IPR013151	546	607	PF00047	Immunoglobulin
	IPR003961	626	715	PF00041	Fibronectin
	IPR003961	728	814	PF00041	Fibronectin
	IPR003961	826	921	PF00041	Fibronectin
	IPR003961	932	1019	PF00041	Fibronectin
HMMSmart	IPR003599	56	147	SM00409	Immunoglobulin subtype
	IPR003598	62	135	SM00408	Immunoglobulin subtype 2
	IPR003599	157	244	SM00409	Immunoglobulin subtype
	IPR003599	263	344	SM00409	Immunoglobulin subtype
	IPR003598	269	333	SM00408	Immunoglobulin subtype 2
	IPR003599	353	436	SM00409	Immunoglobulin subtype
	IPR003598	359	425	SM00408	Immunoglobulin subtype 2
	IPR003599	447	529	SM00409	Immunoglobulin subtype
	IPR003598	453	518	SM00408	Immunoglobulin subtype 2
	IPR003599	538	623	SM00409	Immunoglobulin subtype
	IPR003598	544	612	SM00408	Immunoglobulin subtype 2
	IPR003961	626	712	SM00060	Fibronectin
	IPR003961	729	811	SM00060	Fibronectin
	IPR003961	826	918	SM00060	Fibronectin
	IPR003961	932	1016	SM00060	Fibronectin
ProfileScan	IPR007110	49	139	PS50835	Immunoglobulin-like
	IPR007110	153	240	PS50835	Immunoglobulin-like
	IPR007110	254	342	PS50835	Immunoglobulin-like
	IPR007110	347	434	PS50835	Immunoglobulin-like
	IPR007110	439	521	PS50835	Immunoglobulin-like
	IPR007110	532	621	PS50835	Immunoglobulin-like
	IPR003961	626	721	PS50853	Fibronectin
	IPR003961	728	821	PS50853	Fibronectin
	IPR003961	826	927	PS50853	Fibronectin
	IPR003961	928	1025	PS50853	Fibronectin
	IPR003961	1030	1122	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	10	VPPGKMVVALRYVWPLLLCSPCL	32	SECONDARY	23
SOSUI2	2	1136	WFIGFVSAIILLLLVLLILCFI	1157	PRIMARY	22