ORK01015

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01015

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01015
Clone name	fj11224
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PAK6
cDNA sequence	DNA sequence (4316 bp) Predicted protein sequence (694 aa)
HaloTag ORF Clone	FHC01015
Flexi ORF Clone	FXC01015
Description	Serine/threonine-protein kinase PAK 6 (EC 2.7.11.1) (p21-activated kinase 6) (PAK-6) (PAK-5).

Features of the cloned cDNA sequence

Description

Length: 4316 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1399 bp
Genome contig ID	gi51511731f_38218625
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- GTGCCTGTTTTAAATTAAATTGAGTGTTCAAAGCC
Flanking genome sequence (138356 - 138405)	----+--------+--------+--------+--------+----* ATTGGGCTTCCTGTGTCTCTGGGAGCGGAGACCGGCCGTCTTGGAGGGGG

Features of the protein sequence

Description

Length: 694 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9NQU5	2e-199	100.0	Serine/threonin...	Homo sapiens
AAX43271	2e-199	100.0	p21 [synthetic ...	synthetic construct
ABM86229	2.5e-199	99.8	p21(CDKN1A)-act...	synthetic construct
Q5R8Z4	1.4e-198	99.5	Serine/threonin...	Pongo abelii
XP_001093484	2.6e-196	98.5	p21-activated k...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	426	670	PD000001	Protein kinase
HMMPfam	IPR000095	24	80	PF00786	PAK-box/P21-Rho-binding
HMMPfam	IPR000719	420	671	PF00069	Protein kinase
HMMSmart	IPR000095	25	60	SM00285	PAK-box/P21-Rho-binding
	IPR001245	420	671	SM00219	Tyrosine protein kinase
	IPR002290	420	671	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000095	25	38	PS50108	PAK-box/P21-Rho-binding
ProfileScan	IPR000719	420	671	PS50011	Protein kinase
ScanRegExp	IPR000719	426	449	PS00107	Protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp