ORK01016

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01016

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01016
Clone name	ha02919
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	STK38
cDNA sequence	DNA sequence (4107 bp) Predicted protein sequence (475 aa)
HaloTag ORF Clone	FHC01016
Flexi ORF Clone	FXC01016
Description	Serine/threonine-protein kinase 38 (EC 2.7.11.1) (NDR1 protein kinase) (Nuclear Dbf2-related kinase 1).

Features of the cloned cDNA sequence

Description

Length: 4107 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1891 bp
Genome contig ID	gi89161210r_36469648
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TAACTTTTAAACTTCTGAATAAACTGTGTAAAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTAGTGGAAATACGTGGTGTGATTTATTAAACTGATAAGAACAGATACT

Features of the protein sequence

Description

Length: 475 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5R8M1	2.4e-177	100.0	Serine/threonin...	Pongo abelii
AAQ02509	2.4e-177	100.0	serine/threonin...	synthetic construct
XP_001495015	4.1e-177	99.7	similar to Seri...	Equus caballus
XP_518435	5.4e-177	99.7	serine/threonin...	Pan troglodytes
CAH92600	8.1e-177	99.5	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	99	244	PD000001	Protein kinase
BlastProDom	IPR000719	286	392	PD000001	Protein kinase
HMMPfam	IPR000719	99	392	PF00069	Protein kinase
HMMPfam	IPR000961	410	459	PF00433	Protein kinase
HMMSmart	IPR001245	99	391	SM00219	Tyrosine protein kinase
	IPR002290	99	392	SM00220	Serine/threonine protein kinase
	IPR000961	393	457	SM00133	Protein kinase
ProfileScan	IPR000719	99	392	PS50011	Protein kinase
ScanRegExp	IPR000719	105	128	PS00107	Protein kinase
ScanRegExp	IPR008271	218	230	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp