ORK01017

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01017

Order Kazusa clone(s) from :

Accession No	AB210006
Product ID	ORK01017
Clone name	fg04853
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PIK3C2B
cDNA sequence	DNA sequence (7153 bp) Predicted protein sequence (1645 aa)
HaloTag ORF Clone	FHC01017
Flexi ORF Clone	FXC01017
Description	Phosphatidylinositol-4-phosphate 3-kinase C2 domain-containing beta polypeptide (EC 2.7.1.154) (Phosphoinositide 3-Kinase-C2-beta) (PtdIns-3-kinase C2 beta) (PI3K-C2beta) (C2-PI3K).

Features of the cloned cDNA sequence

Description

Length: 7153 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2215 bp
Genome contig ID	gi89161185r_202558391
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TCGGGAATTGTATTTTCTAATAAATGACATTTGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAATGAAACTATAATTTTATTTATTTTTTTGACACAGGGTCTCTCT

Features of the protein sequence

Description

Length: 1645 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06088	100.0	PIK3C2B variant...	Homo sapiens
O00750	100.0	Phosphatidylino...	Homo sapiens
EAW91513	99.8	phosphoinositid...	Homo sapiens
CAA72168	99.7	phosphoinositid...	Homo sapiens
CAA74194	99.6	PI-3 kinase [Ho...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	1545	1557	PR00360	C2 calcium-dependent membrane targeting
FPrintScan	IPR000008	1574	1587	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR000341	375	477	PF00794	Phosphoinositide 3-kinase
	IPR002420	659	799	PF00792	Phosphoinositide 3-kinase
	IPR001263	816	1003	PF00613	Phosphoinositide 3-kinase accessory region PIK
	IPR000403	1088	1303	PF00454	Phosphatidylinositol 3- and 4-kinase
	IPR001683	1376	1488	PF00787	Phox-like
	IPR000008	1530	1619	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000341	375	477	SM00144	Phosphoinositide 3-kinase
	IPR002420	630	739	SM00142	Phosphoinositide 3-kinase
	IPR001263	816	1002	SM00145	Phosphoinositide 3-kinase accessory region PIK
	IPR000403	1090	1352	SM00146	Phosphatidylinositol 3- and 4-kinase
	IPR001683	1376	1488	SM00312	Phox-like
	IPR000008	1529	1634	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000403	1089	1353	PS50290	Phosphatidylinositol 3- and 4-kinase
	IPR001683	1376	1492	PS50195	Phox-like
	IPR000008	1528	1619	PS50004	C2 calcium-dependent membrane targeting
ScanRegExp	IPR000403	1093	1107	PS00915	Phosphatidylinositol 3- and 4-kinase
ScanRegExp	IPR000403	1191	1211	PS00916	Phosphatidylinositol 3- and 4-kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp