ORK01018

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01018

Order Kazusa clone(s) from :

Accession No	AB210018
Product ID	ORK01018
Clone name	fj16004
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EPHB2
cDNA sequence	DNA sequence (4768 bp) Predicted protein sequence (1004 aa)
HaloTag ORF Clone	FHC01018
Flexi ORF Clone	FXC01018
Description	Ephrin type-B receptor 2 precursor (EC 2.7.10.1) (Tyrosine-protein kinase receptor EPH-3) (DRT) (Receptor protein-tyrosine kinase HEK5) (ERK) (Tyrosine-protein kinase TYRO5) (Renal carcinoma antigen NY-REN- 47).

Features of the cloned cDNA sequence

Description

Length: 4768 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1753 bp
Genome contig ID	gi89161185f_22810009
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTAGTGAATTGAATGGAAATAAACGCTTTAGTTAT
Flanking genome sequence (304396 - 304445)	----+--------+--------+--------+--------+----* AATATGACCCCTGTTCTCTGTAAGTTCCAAGGGAGACCTTGGTACCCTTG

Features of the protein sequence

Description

Length: 1004 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06100	100.0	EPHB2 variant p...	Homo sapiens
AAH62924	99.3	Ephb2 protein [...	Mus musculus
CAI22899	100.0	EPH receptor B2...	Homo sapiens
P29323	100.0	Ephrin type-B r...	Homo sapiens
CAI16428	99.8	EPH receptor B2...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001090	45	217	PD001495	Ephrin receptor
BlastProDom	IPR000719	646	905	PD000001	Protein kinase
FPrintScan	IPR003962	468	477	PR00014	Fibronectin
	IPR003962	481	491	PR00014	Fibronectin
	IPR003962	504	522	PR00014	Fibronectin
	IPR003962	522	536	PR00014	Fibronectin
	IPR001245	717	730	PR00109	Tyrosine protein kinase
	IPR001245	754	772	PR00109	Tyrosine protein kinase
	IPR001245	806	816	PR00109	Tyrosine protein kinase
	IPR001245	825	847	PR00109	Tyrosine protein kinase
	IPR001245	869	891	PR00109	Tyrosine protein kinase
HMMPfam	IPR001090	38	215	PF01404	Ephrin receptor
	IPR003961	343	439	PF00041	Fibronectin
	IPR003961	454	538	PF00041	Fibronectin
	IPR001245	639	898	PF07714	Tyrosine protein kinase
	IPR001660	929	993	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001090	38	215	SM00615	Ephrin receptor
	IPR003961	343	435	SM00060	Fibronectin
	IPR003961	454	535	SM00060	Fibronectin
	IPR002290	639	902	SM00220	Serine/threonine protein kinase
	IPR001245	639	898	SM00219	Tyrosine protein kinase
	IPR001660	928	995	SM00454	Sterile alpha motif SAM
ProfileScan	IPR003961	343	444	PS50853	Fibronectin
	IPR003961	450	545	PS50853	Fibronectin
	IPR000719	639	902	PS50011	Protein kinase
	IPR001660	931	995	PS50105	Sterile alpha motif SAM
ScanRegExp	IPR001426	196	216	PS00790	Receptor tyrosine kinase
	IPR001426	259	279	PS00791	Receptor tyrosine kinase
	IPR013032	272	287	PS01186	EGF-like region
	IPR000719	645	671	PS00107	Protein kinase
	IPR008266	760	772	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	24	LGAALLLLPLLAAVEETLMDSTT	46	SECONDARY	23
SOSUI2	2	560	PLIIGSSAAGLVFLIAVVVIAIV	582	PRIMARY	23