ORK01021

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01021

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01021
Clone name	bm00740
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	PINK1
cDNA sequence	DNA sequence (2411 bp) Predicted protein sequence (594 aa)
HaloTag ORF Clone	FHC01021
Flexi ORF Clone	FXC01021
Description	Serine/threonine-protein kinase PINK1, mitochondrial precursor (EC 2.7.11.1) (PTEN-induced putative kinase protein 1) (BRPK).

Features of the cloned cDNA sequence

Description

Length: 2411 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	625 bp
Genome contig ID	gi89161185f_20732589
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- GAATTGTGAAATATTAAATGCAAATTTACAACTGC
Flanking genome sequence (117809 - 117858)	----+--------+--------+--------+--------+----* AGATGACGTATGTGCCTTGAACTGAATATTTGGCTTTAAGAATGATTCTT

Features of the protein sequence

Description

Length: 594 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BXM7	3.9e-216	100.0	Serine/threonin...	Homo sapiens
AAH28215	1.6e-215	99.8	PTEN induced pu...	Homo sapiens
AAX41013	1.6e-215	99.8	PTEN induced pu...	synthetic construct
XP_001096957	1.3e-209	97.2	similar to PTEN...	Macaca mulatta
AAI42193	1.7e-178	86.1	PINK1 protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	337	515	PD000001	Protein kinase
HMMPfam	IPR000719	279	525	PF00069	Protein kinase
HMMSmart	IPR001245	169	520	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	169	524	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	169	524	PS50011	Protein kinase
ScanRegExp	IPR008271	371	383	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp