Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01026
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01026
Clone name ej00479
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol APBB2
cDNA sequence DNA sequence (3592 bp)
Predicted protein sequence (760 aa)
Flexi ORF Clone FXC01026
Description amyloid beta (A4) precursor protein-binding, family B, member 2
Features of the cloned cDNA sequence

Length: 3592 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 768 bp
Genome contig ID gi89161207r_40412098
PolyA signal sequence
(AATAAA,-18)		 
+----*----+----*----+----*----+----
TATTTTTAAAAGAGATTAATAAAATCATAATGCAT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
TTTGGGTGGGACATATTTCAAACTTCTGCCTTATATTGTACGGTGCAGCT

Features of the protein sequence

Length: 760 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10997 0 100.0 amyloid beta A4...
 synthetic construct
Q92870 0 99.8 Amyloid beta A4...
 Homo sapiens
BAG65114 0 99.7 unnamed protein...
 Homo sapiens
XP_001146547 0 99.6 amyloid beta A4...
 Pan troglodytes
EAW92976 0 99.2 amyloid beta (A...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001202 294 322 PF00397 WW/Rsp5/WWP
IPR006020 421 557 PF00640 Phosphotyrosine interaction region
IPR006020 592 714 PF00640 Phosphotyrosine interaction region
HMMSmart IPR001202 293 324 SM00456 WW/Rsp5/WWP
IPR006020 416 560 SM00462 Phosphotyrosine interaction region
IPR006020 587 717 SM00462 Phosphotyrosine interaction region
ProfileScan IPR001202 292 324 PS50020 WW/Rsp5/WWP
IPR006020 421 557 PS01179 Phosphotyrosine interaction region
IPR006020 591 717 PS01179 Phosphotyrosine interaction region
ScanRegExp IPR001202 298 322 PS01159 WW/Rsp5/WWP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp