ORK01027

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01027

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01027
Clone name	ah04488
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PLEKHA7
cDNA sequence	DNA sequence (5536 bp) Predicted protein sequence (1277 aa)
HaloTag ORF Clone	FHC01027
Flexi ORF Clone	FXC01027
Description	Pleckstrin homology domain-containing family A member 7.

Features of the cloned cDNA sequence

Description

Length: 5536 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1700 bp
Genome contig ID	gi51511727r_16655421
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- AAAAAATGTGATGTACAGATTAAAATATTAACCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATACGTTTCCTGTTTCTTGCTGGCTATAGTCTCTGGTGAGTGGCCTGTGT

Features of the protein sequence

Description

Length: 1277 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11066	100.0	pleckstrin homo...	synthetic construct
XP_001086202	98.2	similar to plec...	Macaca mulatta
XP_508305	99.2	hypothetical pr...	Pan troglodytes
BAE27490	90.0	unnamed protein...	Mus musculus
XP_001078528	89.5	similar to plec...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	16	45	PF00397	WW/Rsp5/WWP
	IPR001202	61	90	PF00397	WW/Rsp5/WWP
	IPR001849	170	287	PF00169	Pleckstrin-like
HMMSmart	IPR001202	15	47	SM00456	WW/Rsp5/WWP
	IPR001202	60	92	SM00456	WW/Rsp5/WWP
	IPR001849	170	289	SM00233	Pleckstrin-like
ProfileScan	IPR001202	14	47	PS50020	WW/Rsp5/WWP
	IPR001202	59	92	PS50020	WW/Rsp5/WWP
	IPR001849	169	287	PS50003	Pleckstrin-like
ScanRegExp	IPR001202	20	45	PS01159	WW/Rsp5/WWP

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp