ORK01096

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01096

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01096
Clone name	hj00601s2
Vector information	The cDNA fragment was inserted at the KpnI (blunt ended)-Not ... The cDNA fragment was inserted at the KpnI (blunt ended)-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GCGCGCGTAA TACGACTCAC TATAGGGCGA ATTGGGGCCG C-5' end of cDNA.
Symbol	ARAP2
cDNA sequence	DNA sequence (7580 bp) Predicted protein sequence (1742 aa)
HaloTag ORF Clone	FHC01096
Flexi ORF Clone	FXC01096
Description	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2

Features of the cloned cDNA sequence

Description

Length: 7580 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1906 bp
Genome contig ID	gi89161207r_35644017
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- GAGTAAACATTAAAATTGTTTTACAAGTCTACTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTGACTTTATTATTTTCAGAAGTTGAAGGTTGTTATTGTGAAATAGA

Features of the protein sequence

Description

Length: 1742 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8WZ64	100.0	Arf-GAP with Rh...	Homo sapiens
EAW92872	99.9	centaurin, delt...	Homo sapiens
AAL32459	99.8	PARX protein [H...	Homo sapiens
XP_001135477	99.1	centaurin delta...	Pan troglodytes
AAI50259	100.0	ARAP2 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	735	754	PR00405	Arf GTPase activating protein
FPrintScan	IPR001164	754	771	PR00405	Arf GTPase activating protein
HMMPfam	IPR001660	43	106	PF00536	Sterile alpha motif SAM
	IPR001849	521	612	PF00169	Pleckstrin-like
	IPR001849	626	717	PF00169	Pleckstrin-like
	IPR001164	723	845	PF01412	Arf GTPase activating protein
	IPR001849	931	1041	PF00169	Pleckstrin-like
	IPR000198	1167	1320	PF00620	RhoGAP
	IPR000159	1364	1458	PF00788	Ras-association
	IPR001849	1473	1575	PF00169	Pleckstrin-like
HMMSmart	IPR001660	42	108	SM00454	Sterile alpha motif SAM
	IPR001849	521	614	SM00233	Pleckstrin-like
	IPR001849	626	719	SM00233	Pleckstrin-like
	IPR001164	724	845	SM00105	Arf GTPase activating protein
	IPR001849	931	1043	SM00233	Pleckstrin-like
	IPR001849	1053	1152	SM00233	Pleckstrin-like
	IPR000198	1164	1340	SM00324	RhoGAP
	IPR001849	1473	1577	SM00233	Pleckstrin-like
ProfileScan	IPR001660	48	108	PS50105	Sterile alpha motif SAM
	IPR001849	520	612	PS50003	Pleckstrin-like
	IPR001849	625	717	PS50003	Pleckstrin-like
	IPR001164	714	849	PS50115	Arf GTPase activating protein
	IPR001849	916	1041	PS50003	Pleckstrin-like
	IPR000198	1154	1335	PS50238	RhoGAP
	IPR000159	1364	1458	PS50200	Ras-association
	IPR001849	1472	1575	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	11	KPVEKYIFLCVCLIVPLFVTQLS	33	PRIMARY	23