Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01102
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01102
Clone name hj03796
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PLEKHG3
cDNA sequence DNA sequence (4977 bp)
Predicted protein sequence (1444 aa)
Flexi ORF Clone FXC01102
Description pleckstrin homology domain containing, family G, member 3
Features of the cloned cDNA sequence

Length: 4977 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 641 bp
Genome contig ID gi51511730f_64140902
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTGCCAATGGTGCAATAACCACTGCTGACCAACCC
Flanking genome sequence
(139915 - 139964)
----+----*----+----*----+----*----+----*----+----*
ACTATGTGTGAACTCCTTCCTAGGCTTGGCTGGGGTAGGGAAGGTTATTC

Features of the protein sequence

Length: 1444 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11214 0 100.0 pleckstrin homo...
synthetic construct
XP_001080822 0 74.3 similar to plec...
Rattus norvegicus
XP_234320 0 74.1 similar to plec...
Rattus norvegicus
XP_510005 0 93.1 similar to FLJ0...
Pan troglodytes
Q4VAC9 0 75.8 Pleckstrin homo...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000219 201 375 PF00621 DH
IPR001849 407 498 PF00169 Pleckstrin-like
HMMSmart IPR000219 201 375 SM00325 DH
IPR001849 407 500 SM00233 Pleckstrin-like
ProfileScan IPR000219 197 376 PS50010 DH
IPR001849 400 498 PS50003 Pleckstrin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp