Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01123
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01123
Clone name hj06848
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MEGF6
cDNA sequence DNA sequence (4501 bp)
Predicted protein sequence (1246 aa)
Flexi ORF Clone FXC01123
Description Multiple epidermal growth factor-like domains 6 precursor (EGF-like domain-containing protein 3) (Multiple EGF-like domain protein 3).
Features of the cloned cDNA sequence

Length: 4501 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 608 bp
Genome contig ID gi89161185r_3296344
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TGTAAACCTAGGAAGGTAAAGGAGCAGGCAACCTC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
CTCGTGGCCTGTGTGTTTGCTGTGTTACGTGGACTCTGTGTGGGCTCCTC

Features of the protein sequence

Length: 1246 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAA32467 0 100.0 MEGF6 [Homo sap...
 Homo sapiens
BAG10386 0 100.0 multiple EGF-li...
 synthetic construct
EAW71454 0 99.9 hCG1810754 [Hom...
 Homo sapiens
O75095 0 99.8 Multiple epider...
 Homo sapiens
CAM21847 0 82.1 multiple EGF-li...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002049 488 506 PR00011 EGF-like
IPR002049 576 594 PR00011 EGF-like
IPR002049 707 725 PR00011 EGF-like
HMMPfam IPR013091 73 112 PF07645 EGF calcium-binding
IPR006209 118 154 PF00008 EGF-like
IPR006209 160 195 PF00008 EGF-like
IPR013091 197 236 PF07645 EGF calcium-binding
IPR006209 247 282 PF00008 EGF-like
IPR013091 324 363 PF07645 EGF calcium-binding
IPR013111 480 506 PF07974 EGF
IPR013111 523 549 PF07974 EGF
IPR002049 703 744 PF00053 EGF-like
IPR002049 785 825 PF00053 EGF-like
IPR002049 829 872 PF00053 EGF-like
IPR006209 911 941 PF00008 EGF-like
IPR002049 958 997 PF00053 EGF-like
IPR013111 1001 1027 PF07974 EGF
IPR002049 1044 1072 PF00053 EGF-like
IPR002049 1130 1158 PF00053 EGF-like
IPR002049 1182 1208 PF00053 EGF-like
HMMSmart IPR001881 73 113 SM00179 EGF-like calcium-binding
IPR006210 76 113 SM00181 EGF
IPR001881 114 155 SM00179 EGF-like calcium-binding
IPR006210 117 155 SM00181 EGF
IPR006210 159 196 SM00181 EGF
IPR001881 160 196 SM00179 EGF-like calcium-binding
IPR001881 197 237 SM00179 EGF-like calcium-binding
IPR006210 200 237 SM00181 EGF
IPR001881 244 283 SM00179 EGF-like calcium-binding
IPR006210 246 283 SM00181 EGF
IPR001881 284 321 SM00179 EGF-like calcium-binding
IPR006210 287 323 SM00181 EGF
IPR001881 324 364 SM00179 EGF-like calcium-binding
IPR006210 327 364 SM00181 EGF
IPR006210 431 464 SM00181 EGF
IPR006210 475 507 SM00181 EGF
IPR002049 480 519 SM00180 EGF-like
IPR006210 518 550 SM00181 EGF
IPR002049 523 562 SM00180 EGF-like
IPR006210 552 595 SM00181 EGF
IPR002049 566 607 SM00180 EGF-like
IPR006210 597 640 SM00181 EGF
IPR002049 611 652 SM00180 EGF-like
IPR006210 651 682 SM00181 EGF
IPR002049 656 694 SM00180 EGF-like
IPR006210 693 726 SM00181 EGF
IPR002049 698 738 SM00180 EGF-like
IPR006210 737 769 SM00181 EGF
IPR002049 742 781 SM00180 EGF-like
IPR006210 780 813 SM00181 EGF
IPR002049 785 825 SM00180 EGF-like
IPR006210 824 856 SM00181 EGF
IPR002049 829 868 SM00180 EGF-like
IPR006210 867 899 SM00181 EGF
IPR002049 872 911 SM00180 EGF-like
IPR006210 910 942 SM00181 EGF
IPR002049 916 954 SM00180 EGF-like
IPR006210 953 985 SM00181 EGF
IPR002049 958 997 SM00180 EGF-like
IPR006210 996 1028 SM00181 EGF
IPR002049 1001 1040 SM00180 EGF-like
IPR006210 1039 1071 SM00181 EGF
IPR002049 1044 1083 SM00180 EGF-like
IPR006210 1082 1114 SM00181 EGF
IPR002049 1087 1126 SM00180 EGF-like
IPR006210 1125 1157 SM00181 EGF
IPR002049 1130 1178 SM00180 EGF-like
IPR006210 1177 1209 SM00181 EGF
IPR002049 1182 1210 SM00180 EGF-like
ProfileScan IPR000742 73 113 PS50026 EGF-like
IPR000742 150 196 PS50026 EGF-like
IPR000742 197 237 PS50026 EGF-like
IPR000742 324 364 PS50026 EGF-like
IPR000742 428 464 PS50026 EGF-like
IPR000742 472 507 PS50026 EGF-like
IPR000742 515 550 PS50026 EGF-like
IPR000742 648 682 PS50026 EGF-like
IPR000742 695 726 PS50026 EGF-like
IPR000742 734 769 PS50026 EGF-like
IPR000742 777 813 PS50026 EGF-like
IPR000742 821 856 PS50026 EGF-like
IPR000742 907 942 PS50026 EGF-like
IPR000742 950 985 PS50026 EGF-like
IPR000742 993 1028 PS50026 EGF-like
IPR000742 1036 1071 PS50026 EGF-like
IPR000742 1079 1114 PS50026 EGF-like
IPR000742 1127 1157 PS50026 EGF-like
IPR000742 1174 1209 PS50026 EGF-like
ScanRegExp IPR001881 73 97 PS01187 EGF-like calcium-binding
IPR000152 88 99 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 97 112 PS01186 EGF-like region
IPR013032 139 154 PS01186 EGF-like region
IPR013032 180 195 PS01186 EGF-like region
IPR001881 197 221 PS01187 EGF-like calcium-binding
IPR000152 212 223 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 221 236 PS01186 EGF-like region
IPR013032 267 282 PS01186 EGF-like region
IPR001881 284 307 PS01187 EGF-like calcium-binding
IPR000152 298 309 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 307 322 PS01186 EGF-like region
IPR001881 324 348 PS01187 EGF-like calcium-binding
IPR000152 339 350 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 348 363 PS01186 EGF-like region
IPR013032 452 463 PS00022 EGF-like region
IPR013032 452 467 PS01186 EGF-like region
IPR013032 495 506 PS00022 EGF-like region
IPR013032 538 549 PS00022 EGF-like region
IPR013032 583 594 PS00022 EGF-like region
IPR013032 583 598 PS01186 EGF-like region
IPR013032 670 681 PS00022 EGF-like region
IPR013032 714 725 PS00022 EGF-like region
IPR013032 714 729 PS01186 EGF-like region
IPR013032 757 768 PS00022 EGF-like region
IPR013032 757 772 PS01186 EGF-like region
IPR013032 801 812 PS00022 EGF-like region
IPR013032 801 816 PS01186 EGF-like region
IPR013032 844 855 PS00022 EGF-like region
IPR013032 844 859 PS01186 EGF-like region
IPR013032 887 898 PS00022 EGF-like region
IPR013032 930 941 PS00022 EGF-like region
IPR013032 930 945 PS01186 EGF-like region
IPR013032 973 984 PS00022 EGF-like region
IPR013032 973 988 PS01186 EGF-like region
IPR013032 1016 1027 PS00022 EGF-like region
IPR013032 1016 1031 PS01186 EGF-like region
IPR013032 1059 1070 PS00022 EGF-like region
IPR013032 1102 1113 PS00022 EGF-like region
IPR013032 1102 1117 PS01186 EGF-like region
IPR013032 1145 1156 PS00022 EGF-like region
IPR013032 1145 1156 PS01186 EGF-like region
IPR013032 1197 1208 PS00022 EGF-like region
IPR013032 1197 1208 PS01186 EGF-like region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp