ORK01155

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01155

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01155
Clone name	fh03522s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZNF644
cDNA sequence	DNA sequence (5798 bp) Predicted protein sequence (1329 aa)
HaloTag ORF Clone	FHC01155
Flexi ORF Clone	FXC01155
Description	zinc finger protein 644

Features of the cloned cDNA sequence

Description

Length: 5798 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1496 bp
Genome contig ID	gi89161185r_91053447
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AAAATCTCTAAATAAAAAAAGGTTTAAAGAAAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATGTGAAACATTTCTTATTTTTATCATTGGTGGTAATAGTTCACTTC

Features of the protein sequence

Description

Length: 1329 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H582	100.0	Zinc finger pro...	Homo sapiens
AAI50178	99.8	ZNF644 protein ...	Homo sapiens
AAH63683	100.0	ZNF644 protein ...	Homo sapiens
XP_001493620	94.4	similar to MGC1...	Equus caballus
XP_853224	94.6	similar to zinc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	412	434	PF00096	Zinc finger
HMMPfam	IPR007087	450	472	PF00096	Zinc finger
HMMSmart	IPR015880	412	434	SM00355	Zinc finger
	IPR015880	450	472	SM00355	Zinc finger
	IPR015880	498	520	SM00355	Zinc finger
	IPR015880	527	550	SM00355	Zinc finger
	IPR015880	588	611	SM00355	Zinc finger
	IPR015880	965	987	SM00355	Zinc finger
	IPR015880	1040	1062	SM00355	Zinc finger
	IPR015880	1263	1289	SM00355	Zinc finger
ProfileScan	IPR007087	412	439	PS50157	Zinc finger
	IPR007087	450	477	PS50157	Zinc finger
	IPR007087	1040	1062	PS50157	Zinc finger
ScanRegExp	IPR007087	414	434	PS00028	Zinc finger
	IPR007087	452	472	PS00028	Zinc finger
	IPR007087	967	989	PS00028	Zinc finger
	IPR007087	1042	1062	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp