Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01193
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB210027
Product ID ORK01193
Clone name hh01833
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol LAMA4
cDNA sequence DNA sequence (6027 bp)
Predicted protein sequence (1852 aa)
Flexi ORF Clone FXC01193
Description Laminin subunit alpha-4 precursor.
Features of the cloned cDNA sequence

Length: 6027 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 305 bp
Genome contig ID gi89161210r_112437028
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTTCTGTTTCTAATAAAATAGAAGGGATTCCAAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACACTTGCACACATTTTTGAAGTGCGGCTAGATTCTCAGATTCACCTT

Features of the protein sequence

Length: 1852 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06109 0 100.0 LAMA4 variant p...
Homo sapiens
XP_518696 0 99.2 laminin, alpha ...
Pan troglodytes
BAG10533 0 100.0 laminin subunit...
synthetic construct
CAI12950 0 99.9 laminin, alpha ...
Homo sapiens
EAW48268 0 99.8 laminin, alpha ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002049 111 158 PF00053 EGF-like
IPR002049 161 213 PF00053 EGF-like
IPR002049 216 267 PF00053 EGF-like
IPR009254 324 584 PF06008 Laminin I
IPR010307 763 890 PF06009 Laminin II
IPR012680 904 1043 PF02210 Laminin G
IPR012680 1108 1239 PF02210 Laminin G
IPR012680 1292 1408 PF02210 Laminin G
IPR012680 1528 1655 PF02210 Laminin G
IPR012680 1705 1830 PF02210 Laminin G
HMMSmart IPR002049 111 158 SM00180 EGF-like
IPR006210 119 159 SM00181 EGF
IPR002049 161 213 SM00180 EGF-like
IPR006210 174 214 SM00181 EGF
IPR002049 216 267 SM00180 EGF-like
IPR006210 230 268 SM00181 EGF
IPR001791 886 1043 SM00282 Laminin G
IPR001791 1100 1239 SM00282 Laminin G
IPR001791 1284 1408 SM00282 Laminin G
IPR001791 1520 1655 SM00282 Laminin G
IPR001791 1697 1830 SM00282 Laminin G
ProfileScan IPR002049 111 160 PS50027 EGF-like
IPR002049 161 215 PS50027 EGF-like
IPR002049 216 269 PS50027 EGF-like
IPR001791 862 1064 PS50025 Laminin G
IPR001791 1076 1256 PS50025 Laminin G
IPR001791 1263 1431 PS50025 Laminin G
IPR001791 1498 1669 PS50025 Laminin G
IPR001791 1676 1849 PS50025 Laminin G
ScanRegExp IPR002049 127 161 PS01248 EGF-like
IPR013032 184 195 PS00022 EGF-like region
IPR002049 184 218 PS01248 EGF-like
IPR002049 238 272 PS01248 EGF-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp