ORK01194

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01194

Order Kazusa clone(s) from :

Accession No	AB210032
Product ID	ORK01194
Clone name	hh11923
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ARID4B
cDNA sequence	DNA sequence (5544 bp) Predicted protein sequence (1325 aa)
HaloTag ORF Clone	FHC01194
Flexi ORF Clone	FXC01194
Description	AT-rich interactive domain-containing protein 4B (ARID domain- containing protein 4B) (Histone deacetylase complex subunit SAP180) (180 kDa Sin3-associated polypeptide) (Sin3-associated polypeptide p180) (Retinoblastoma-binding protein 1-like 1) (Breast c

Features of the cloned cDNA sequence

Description

Length: 5544 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1228 bp
Genome contig ID	gi89161185r_233297235
PolyA signal sequence (AATACA,-20)	+--------+--------+----*----+---- ATATCTGGCACTGTTAATACACAGTACTTTATTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAGACTGTTTTACTGTTTTAATTGTAGTTCTGTGTACTTTTTTTGGATG

Features of the protein sequence

Description

Length: 1325 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06114	100.0	ARID4B variant ...	Homo sapiens
Q4LE39	100.0	AT-rich interac...	Homo sapiens
AAO63590	99.6	SIN3A-associate...	Homo sapiens
XP_001154237	99.4	AT rich interac...	Pan troglodytes
XP_001110827	98.5	similar to AT r...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012603	179	277	PF08169	RBB1NT
HMMPfam	IPR001606	316	426	PF01388	AT-rich interaction region
HMMSmart	IPR002999	71	127	SM00333	Tudor
	IPR001606	320	412	SM00501	AT-rich interaction region
	IPR002999	580	645	SM00333	Tudor
ProfileScan	IPR001606	319	411	PS51011	AT-rich interaction region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp