ORK01195

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01195

Order Kazusa clone(s) from :

Accession No	AB210034
Product ID	ORK01195
Clone name	hj06729
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PRRC2A
cDNA sequence	DNA sequence (5011 bp) Predicted protein sequence (1537 aa)
HaloTag ORF Clone	FHC01195
Flexi ORF Clone	FXC01195
Description	Large proline-rich protein BAT2 (HLA-B-associated transcript 2).

Features of the cloned cDNA sequence

Description

Length: 5011 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	174 bp
Genome contig ID	gi89161210f_31596443
PolyA signal sequence (AATAAA,-13)	+--------+--------+----*----+---- GGGCTGTTTGTTAAAAAAGAGTAATAAAAGGATTT
Flanking genome sequence (117075 - 117124)	----+--------+--------+--------+--------+----* AAAAAAAAAAACTTCTACAATGATTTGGGGGATGAGTTGTTTGCATTGTC

Features of the protein sequence

Description

Length: 1537 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE06116	0	100.0	C6orf21 variant...	Homo sapiens
BAG10536	0	100.0	large proline-r...	synthetic construct
XP_001155374	0	99.2	HLA-B associate...	Pan troglodytes
XP_001250581	0	92.9	similar to HLA-...	Bos taurus
CAQ06959	1.6e-205	71.0	HLA-B associate...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009738	5	196	PF07001	BAT2

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp