ORK01197

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01197

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01197
Clone name	hk05083
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DDB1
cDNA sequence	DNA sequence (4258 bp) Predicted protein sequence (1192 aa)
HaloTag ORF Clone	FHC01197
Flexi ORF Clone	FXC01197
Description	DNA damage-binding protein 1 (Damage-specific DNA-binding protein 1) (UV-damaged DNA-binding factor) (DDB p127 subunit) (DDBa) (UV-damaged DNA-binding protein 1) (UV-DDB 1) (Xeroderma pigmentosum group E- complementing protein) (XPCe) (XPE-binding factor)

Features of the cloned cDNA sequence

Description

Length: 4258 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	679 bp
Genome contig ID	gi51511727r_60723505
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GTTTCTGAGTTTTACCAAATAAAGTAGAATATAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAAAGGTACATTTGTTTTTGCTTTTATTCACCCTGCCCAGCTATCCAG

Features of the protein sequence

Description

Length: 1192 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q16531	100.0	DNA damage-bind...	Homo sapiens
XP_533275	99.9	similar to DNA ...	Canis lupus fam...
P33194	99.9	DNA damage-bind...	Chlorocebus aet...
Q5R649	99.8	DNA damage-bind...	Pongo abelii
A1A4K3	99.7	DNA damage-bind...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004871	837	1121	PF03178	CPSF A subunit

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp