ORK01198

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01198

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01198
Clone name	fh08793
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EPHB6
cDNA sequence	DNA sequence (5166 bp) Predicted protein sequence (1024 aa)
HaloTag ORF Clone	FHC01198
Flexi ORF Clone	FXC01198
Description	Ephrin type-B receptor 6 precursor (Tyrosine-protein kinase-defective receptor EPH-6) (HEP).

Features of the cloned cDNA sequence

Description

Length: 5166 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	188 bp
Genome contig ID	gi89161213f_142162166
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- CCCCCTCCTCATTAAAGGGAAAGAAGGGAATTTGC
Flanking genome sequence (116803 - 116852)	----+--------+--------+--------+--------+----* AAGTTTGGTGTGGTGAGGCCTCAGTCTGCAACAAAGGGTGAGGGAGGCCT

Features of the protein sequence

Description

Length: 1024 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW51900	100.0	EPH receptor B6...	Homo sapiens
XP_519443	99.4	ephrin receptor...	Pan troglodytes
O15197	100.0	Ephrin type-B r...	Homo sapiens
XP_001089756	98.5	similar to ephr...	Macaca mulatta
P0C0K6	99.3	Ephrin type-B r...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001090	43	236	PD001495	Ephrin receptor
BlastProDom	IPR000719	680	925	PD000001	Protein kinase
FPrintScan	IPR003962	505	514	PR00014	Fibronectin
	IPR003962	518	528	PR00014	Fibronectin
	IPR003962	541	559	PR00014	Fibronectin
	IPR003962	559	573	PR00014	Fibronectin
	IPR001245	751	764	PR00109	Tyrosine protein kinase
	IPR001245	826	836	PR00109	Tyrosine protein kinase
	IPR001245	845	867	PR00109	Tyrosine protein kinase
	IPR001245	889	911	PR00109	Tyrosine protein kinase
HMMPfam	IPR001090	36	235	PF01404	Ephrin receptor
	IPR003961	373	473	PF00041	Fibronectin
	IPR003961	491	575	PF00041	Fibronectin
	IPR001245	673	918	PF07714	Tyrosine protein kinase
	IPR011510	948	1015	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001090	36	235	SM00615	Ephrin receptor
	IPR003961	373	472	SM00060	Fibronectin
	IPR003961	491	572	SM00060	Fibronectin
	IPR002290	673	922	SM00220	Serine/threonine protein kinase
	IPR001245	673	918	SM00219	Tyrosine protein kinase
	IPR001660	948	1015	SM00454	Sterile alpha motif SAM
ProfileScan	IPR003961	372	481	PS50853	Fibronectin
	IPR003961	491	582	PS50853	Fibronectin
	IPR000719	673	922	PS50011	Protein kinase
	IPR001660	959	1015	PS50105	Sterile alpha motif SAM
ScanRegExp	IPR001426	216	236	PS00790	Receptor tyrosine kinase
	IPR001426	289	309	PS00791	Receptor tyrosine kinase
	IPR013032	302	317	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	20	VCSLWVLLLVSSVLALEEVLLDT	42	PRIMARY	23
SOSUI2	2	598	LVIGSILGALAFLLLAAITVLAV	620	PRIMARY	23