ORK01201

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01201

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01201
Clone name	hj08005
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PIK3R4
cDNA sequence	DNA sequence (4984 bp) Predicted protein sequence (1383 aa)
HaloTag ORF Clone	FHC01201
Flexi ORF Clone	FXC01201
Description	Phosphoinositide 3-kinase regulatory subunit 4 (EC 2.7.11.1) (PI3- kinase regulatory subunit 4) (PI3-kinase p150 subunit) (Phosphoinositide 3-kinase adaptor protein).

Features of the cloned cDNA sequence

Description

Length: 4984 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	380 bp
Genome contig ID	gi89161205r_131780469
PolyA signal sequence (ATTAAA,-32)	+--------+--------+----*----+---- GCTATTAAAAATGCTATTCAAAGCAGTTAAACTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCATGCATCCTAAGAGTTTGTGGTTTTGGTGGTATTTTTAAATGGTAA

Features of the protein sequence

Description

Length: 1383 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q99570	100.0	Phosphoinositid...	Homo sapiens
AAI27106	99.9	Phosphoinositid...	Homo sapiens
XP_516746	99.9	phosphoinositid...	Pan troglodytes
BAG36893	99.8	unnamed protein...	Homo sapiens
Q5R9I3	99.1	Phosphoinositid...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	55	330	PD000001	Protein kinase
FPrintScan	IPR001680	1033	1047	PR00320	WD40 repeat
	IPR001680	1281	1295	PR00320	WD40 repeat
	IPR001680	1370	1383	PR00320	WD40 repeat
HMMPfam	IPR000719	51	335	PF00069	Protein kinase
	IPR000357	437	473	PF02985	HEAT
	IPR000357	482	518	PF02985	HEAT
	IPR001680	1008	1046	PF00400	WD40 repeat
	IPR001680	1254	1294	PF00400	WD40 repeat
	IPR001680	1344	1383	PF00400	WD40 repeat
HMMSmart	IPR002290	51	345	SM00220	Serine/threonine protein kinase
	IPR001680	1007	1046	SM00320	WD40 repeat
	IPR001680	1056	1095	SM00320	WD40 repeat
	IPR001680	1157	1194	SM00320	WD40 repeat
	IPR001680	1196	1239	SM00320	WD40 repeat
	IPR001680	1253	1294	SM00320	WD40 repeat
	IPR001680	1342	1383	SM00320	WD40 repeat
ProfileScan	IPR000719	51	349	PS50011	Protein kinase
	IPR000357	488	518	PS50077	HEAT
	IPR001680	1014	1055	PS50082	WD40 repeat
	IPR001680	1014	1303	PS50294	WD40 repeat
	IPR001680	1350	1383	PS50082	WD40 repeat
	IPR001680	1350	1383	PS50294	WD40 repeat
ScanRegExp	IPR008271	169	181	PS00108	Serine/threonine protein kinase
	IPR001680	1226	1240	PS00678	WD40 repeat
	IPR001680	1281	1295	PS00678	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp