ORK01202

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01202

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01202
Clone name	hk07352
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DHX8
cDNA sequence	DNA sequence (4178 bp) Predicted protein sequence (1235 aa)
HaloTag ORF Clone	FHC01202
Flexi ORF Clone	FXC01202
Description	ATP-dependent RNA helicase DHX8 (EC 3.6.1.-) (DEAH box protein 8) (RNA helicase HRH1).

Features of the cloned cDNA sequence

Description

Length: 4178 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	469 bp
Genome contig ID	gi51511734f_38816886
PolyA signal sequence (None)	+--------+--------+----*----+---- TGACCTCGTGGAAATATTTATTTTCTTAAGGAAAC
Flanking genome sequence (140326 - 140375)	----+--------+--------+--------+--------+----* AAAAATGGTTTTCTGTGACTGTTTTCTTTTAGCCGAAAGGTTAGGATATT

Features of the protein sequence

Description

Length: 1235 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14562	100.0	ATP-dependent R...	Homo sapiens
AAH44586	99.9	DEAH (Asp-Glu-A...	Homo sapiens
AAH47327	99.8	DEAH (Asp-Glu-A...	Homo sapiens
BAF84353	99.8	unnamed protein...	Homo sapiens
XP_616213	98.4	similar to DEAH...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013957	168	253	PF08648	Protein of unknown function DUF1777
	IPR003029	276	351	PF00575	S1
	IPR001650	816	910	PF00271	DNA/RNA helicase
	IPR007502	971	1061	PF04408	Helicase-associated region
	IPR011709	1095	1195	PF07717	Domain of unknown function DUF1605
HMMSmart	IPR003029	278	351	SM00316	S1
	IPR014001	578	762	SM00487	DEAD-like helicases
	IPR001650	806	910	SM00490	DNA/RNA helicase
ProfileScan	IPR003029	280	351	PS50126	S1
	IPR014021	590	753	PS51192	Helicase
	IPR001650	771	951	PS51194	DNA/RNA helicase
ScanRegExp	IPR003439	328	342	PS00211	ABC transporter related
ScanRegExp	IPR002464	695	704	PS00690	DNA/RNA helicase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp