Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01203
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01203
Clone name hk06295
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol OGDH
cDNA sequence DNA sequence (4220 bp)
Predicted protein sequence (1049 aa)
Flexi ORF Clone FXC01203
Description 2-oxoglutarate dehydrogenase E1 component, mitochondrial precursor (EC 1.2.4.2) (Alpha-ketoglutarate dehydrogenase).
Features of the cloned cDNA sequence

Length: 4220 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1068 bp
Genome contig ID gi89161213f_44512725
PolyA signal sequence
(CATAAA,-24)
+----*----+----*----+----*----+----
TTGGCTTGACCCATAAACTAAGTTATATCCGTGGG
Flanking genome sequence
(202469 - 202518)
----+----*----+----*----+----*----+----*----+----*
CATGTCTGCTGTGTCTTTCTGTCTGTTCTGCCTTCTCCCCTGAGGGGATG

Features of the protein sequence

Length: 1049 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10545 0 100.0 oxoglutarate de...
synthetic construct
Q02218 0 99.9 2-oxoglutarate ...
Homo sapiens
Q60HE2 0 99.8 2-oxoglutarate ...
Macaca fascicularis
XP_001146956 0 99.8 oxoglutarate (a...
Pan troglodytes
Q5RCB8 0 99.7 2-oxoglutarate ...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001017 282 608 PF00676 Dehydrogenase
IPR005475 675 892 PF02779 Transketolase
HMMTigr IPR011603 75 1040 TIGR00239 2-oxoglutarate dehydrogenase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp