ORK01204

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01204

Order Kazusa clone(s) from :

Accession No	AB210020
Product ID	ORK01204
Clone name	fk03260
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PIK3CA
cDNA sequence	DNA sequence (3680 bp) Predicted protein sequence (1069 aa)
HaloTag ORF Clone	FHC01204
Flexi ORF Clone	FXC01204
Description	Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha isoform (EC 2.7.1.153) (PI3-kinase p110 subunit alpha) (PtdIns-3- kinase p110) (PI3K).

Features of the cloned cDNA sequence

Description

Length: 3680 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	468 bp
Genome contig ID	gi89161205f_180299303
PolyA signal sequence (None)	+--------+--------+----*----+---- CTGGAGTTTATGTTAAATTACATTGATTGGAAAAG
Flanking genome sequence (136013 - 136062)	----+--------+--------+--------+--------+----* AATGAAAATTTCTTATTTTTCCATTGCTGTTCAATTTATAGTTTGAAGTG

Features of the protein sequence

Description

Length: 1069 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06102	100.0	PIK3CA variant ...	Homo sapiens
2RD0	99.9
P42336	100.0	Phosphatidylino...	Homo sapiens
AAQ02532	99.9	phosphoinositid...	synthetic construct
BAF85629	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003113	32	109	PF02192	Phosphatidylinositol 3-kinase
	IPR000341	174	293	PF00794	Phosphoinositide 3-kinase
	IPR002420	351	486	PF00792	Phosphoinositide 3-kinase
	IPR001263	520	705	PF00613	Phosphoinositide 3-kinase accessory region PIK
	IPR000403	797	1016	PF00454	Phosphatidylinositol 3- and 4-kinase
HMMSmart	IPR003113	32	109	SM00143	Phosphatidylinositol 3-kinase
	IPR000341	174	293	SM00144	Phosphoinositide 3-kinase
	IPR002420	323	426	SM00142	Phosphoinositide 3-kinase
	IPR001263	519	705	SM00145	Phosphoinositide 3-kinase accessory region PIK
	IPR000403	799	1066	SM00146	Phosphatidylinositol 3- and 4-kinase
ProfileScan	IPR000403	798	1069	PS50290	Phosphatidylinositol 3- and 4-kinase
ScanRegExp	IPR000403	802	816	PS00915	Phosphatidylinositol 3- and 4-kinase
ScanRegExp	IPR000403	901	921	PS00916	Phosphatidylinositol 3- and 4-kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp