Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01205
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01205
Clone name fj15863
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SEC23IP
cDNA sequence DNA sequence (4180 bp)
Predicted protein sequence (1003 aa)
Flexi ORF Clone FXC01205
Description SEC23-interacting protein (p125).
Features of the cloned cDNA sequence

Length: 4180 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1168 bp
Genome contig ID gi89161187f_121542276
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATAAAGCAGTAACATTAATGCATTTTTTAAGCAGC
Flanking genome sequence
(148961 - 149010)
----+----*----+----*----+----*----+----*----+----*
AAACTTATGTATTTCTCTTGTCTTCCTTAAAAGTGTCCCCATGAACTCAG

Features of the protein sequence

Length: 1003 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW49372 0 100.0 SEC23 interacti...
Homo sapiens
Q9Y6Y8 0 99.9 SEC23-interacti...
Homo sapiens
BAG50859 0 99.8 unnamed protein...
Homo sapiens
XP_508076 0 99.0 Sec23-interacti...
Pan troglodytes
XP_001100615 0 98.3 Sec23-interacti...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001660 645 706 PF00536 Sterile alpha motif SAM
IPR004177 782 992 PF02862 DDHD
HMMSmart IPR001660 644 709 SM00454 Sterile alpha motif SAM
ProfileScan IPR004177 782 992 PS51043 DDHD
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp