ORK01206

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01206

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01206
Clone name	af00683
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SEMA5A
cDNA sequence	DNA sequence (8037 bp) Predicted protein sequence (1094 aa)
HaloTag ORF Clone	FHC01206
Flexi ORF Clone	FXC01206
Description	Semaphorin-5A precursor (Semaphorin F) (Sema F).

Features of the cloned cDNA sequence

Description

Length: 8037 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4150 bp
Genome contig ID	gi51511721r_8992141
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCATCCTGGGTGACAGAGAGAGACCCTGTCTC
Flanking genome sequence (99718 - 99669)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGAACAAAGTCTTAGCGGGGGGTCTCTATGTCCCCA

Features of the protein sequence

Description

Length: 1094 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q13591	100.0	Semaphorin-5A; ...	Homo sapiens
XP_001145555	99.9	semaphorin 5A i...	Pan troglodytes
AAC09473	99.5	semaphorin F ho...	Homo sapiens
XP_001083962	98.5	similar to sema...	Macaca mulatta
XP_001917420	96.1	sema domain, se...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008085	805	818	PR01705	Thrombospondin
	IPR008085	823	834	PR01705	Thrombospondin
	IPR008085	949	960	PR01705	Thrombospondin
HMMPfam	IPR001627	78	488	PF01403	Semaphorin/CD100 antigen
	IPR002165	506	553	PF01437	Plexin
	IPR000884	619	670	PF00090	Thrombospondin
	IPR000884	677	721	PF00090	Thrombospondin
	IPR000884	808	858	PF00090	Thrombospondin
	IPR000884	865	915	PF00090	Thrombospondin
	IPR000884	920	963	PF00090	Thrombospondin
HMMSmart	IPR001627	78	488	SM00630	Semaphorin/CD100 antigen
	IPR003659	506	553	SM00423	Plexin/semaphorin/integrin
	IPR000884	563	617	SM00209	Thrombospondin
	IPR000884	618	671	SM00209	Thrombospondin
	IPR000884	676	722	SM00209	Thrombospondin
	IPR000884	807	859	SM00209	Thrombospondin
	IPR000884	864	916	SM00209	Thrombospondin
	IPR000884	919	966	SM00209	Thrombospondin
ProfileScan	IPR001627	55	504	PS51004	Semaphorin/CD100 antigen
	IPR000884	560	613	PS50092	Thrombospondin
	IPR000884	615	671	PS50092	Thrombospondin
	IPR000884	673	722	PS50092	Thrombospondin
	IPR000884	804	859	PS50092	Thrombospondin
	IPR000884	861	916	PS50092	Thrombospondin
	IPR000884	917	964	PS50092	Thrombospondin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	19	PTMKGTCVIAWLFSSLGLWRLAH	41	SECONDARY	23
SOSUI2	2	988	MFHMIAVGLSSSILGCLLTLLVY	1010	PRIMARY	23