Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01207
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209995
Product ID ORK01207
Clone name ef01094
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MTOR
cDNA sequence DNA sequence (8701 bp)
Predicted protein sequence (2583 aa)
Flexi ORF Clone FXC01207
Description FKBP12-rapamycin complex-associated protein (FK506-binding protein 12- rapamycin complex-associated protein 1) (Rapamycin target protein) (RAPT1) (Mammalian target of rapamycin) (mTOR).
Features of the cloned cDNA sequence

Length: 8701 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 949 bp
Genome contig ID gi89161185r_10989180
PolyA signal sequence
(AATAAA,-27)		 
+----*----+----*----+----*----+----
TTTGTGCCAATAAATGACATCAGAATTTTAAACAT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ATGTATATGAGTGGCGTTTTAGTCATAATTTTGATCAGTTCAAAAAGGAA

Features of the protein sequence

Length: 2583 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06077 0 100.0 FRAP1 variant p...
 Homo sapiens
EDL14819 0 98.7 FK506 binding p...
 Mus musculus
BAG10549 0 100.0 FKBP12-rapamyci...
 synthetic construct
P42345 0 99.9 Serine/threonin...
 Homo sapiens
2014422A 0 99.8 FKBP-rapamycin-...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003151 1547 1944 PF02259 PIK-related kinase
IPR009076 2049 2148 PF08771 FKBP12-rapamycin-associated protein
IPR000403 2215 2465 PF00454 Phosphatidylinositol 3- and 4-kinase
IPR003152 2551 2583 PF02260 PIK-related kinase
HMMSmart IPR000403 2217 2518 SM00146 Phosphatidylinositol 3- and 4-kinase
ProfileScan IPR014009 1416 2016 PS51189 PIK-related kinase
IPR000403 2216 2583 PS50290 Phosphatidylinositol 3- and 4-kinase
IPR003152 2551 2583 PS51190 PIK-related kinase
ScanRegExp IPR000403 2220 2234 PS00915 Phosphatidylinositol 3- and 4-kinase
IPR000403 2357 2377 PS00916 Phosphatidylinositol 3- and 4-kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp