ORK01210

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01210

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01210
Clone name	hj04180
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DGKQ
cDNA sequence	DNA sequence (4932 bp) Predicted protein sequence (961 aa)
HaloTag ORF Clone	FHC01210
Flexi ORF Clone	FXC01210
Description	Diacylglycerol kinase theta (EC 2.7.1.107) (Diglyceride kinase theta) (DGK-theta) (DAG kinase theta).

Features of the cloned cDNA sequence

Description

Length: 4932 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2044 bp
Genome contig ID	gi89161207r_842364
PolyA signal sequence (None)	+--------+--------+----*----+---- CCAGGCCACGCAAGAACCACTGCGGCCTGCCCGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTGGCTTCCCCTGCCCAGCATCCTGTCCTCCCTGGTCCATCTCTGGTG

Features of the protein sequence

Description

Length: 961 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10554	100.0	diacylglycerol ...	synthetic construct
NP_001338	99.8	diacylglycerol ...	Homo sapiens
AAH63801	99.7	Diacylglycerol ...	Homo sapiens
P52824	99.0	Diacylglycerol ...	Homo sapiens
EAW82632	99.7	diacylglycerol ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001206	602	705	PD005043	Diacylglycerol kinase
BlastProDom	IPR000756	888	938	PD002939	Diacylglycerol kinase accessory region
FPrintScan	IPR002219	77	91	PR00008	Protein kinase C
	IPR002219	93	102	PR00008	Protein kinase C
	IPR002219	230	241	PR00008	Protein kinase C
	IPR002219	242	254	PR00008	Protein kinase C
HMMPfam	IPR002219	80	130	PF00130	Protein kinase C
	IPR011424	152	180	PF07649	C1-like
	IPR002219	203	256	PF00130	Protein kinase C
	IPR000159	315	363	PF00788	Ras-association
	IPR000159	414	513	PF00788	Ras-association
	IPR001206	607	734	PF00781	Diacylglycerol kinase
	IPR000756	760	912	PF00609	Diacylglycerol kinase accessory region
HMMSmart	IPR002219	80	127	SM00109	Protein kinase C
	IPR002219	141	187	SM00109	Protein kinase C
	IPR002219	201	253	SM00109	Protein kinase C
	IPR000159	414	513	SM00314	Ras-association
	IPR001206	607	734	SM00046	Diacylglycerol kinase
	IPR000756	760	912	SM00045	Diacylglycerol kinase accessory region
ProfileScan	IPR002219	79	127	PS50081	Protein kinase C
	IPR002219	140	187	PS50081	Protein kinase C
	IPR002219	202	253	PS50081	Protein kinase C
	IPR000159	414	513	PS50200	Ras-association
ScanRegExp	IPR002219	80	127	PS00479	Protein kinase C
	IPR002219	141	187	PS00479	Protein kinase C
	IPR002219	203	253	PS00479	Protein kinase C

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp