Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01211
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01211
Clone name fj08602
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF224
cDNA sequence DNA sequence (3936 bp)
Predicted protein sequence (750 aa)
Flexi ORF Clone FXC01211
Description Zinc finger protein 224 (Zinc finger protein 27) (Zinc finger protein 233) (Zinc finger protein 255) (Bone marrow zinc finger 2) (BMZF-2) (Zinc finger protein KOX22).
Features of the cloned cDNA sequence

Length: 3936 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1540 bp
Genome contig ID gi42406306f_49190367
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
TCATAACCTAATCAAATAAATATCTTTGTGTGTTT
Flanking genome sequence
(115452 - 115501)		 
----+----*----+----*----+----*----+----*----+----*
TATGTTCTTTTGAGTGTTTACATACTGTGTAAATGAATATTTTTACTGAT

Features of the protein sequence

Length: 750 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001146572 0 99.5 zinc finger pro...
 Pan troglodytes
BAG10556 0 100.0 zinc finger pro...
 synthetic construct
Q9NZL3 0 99.8 Zinc finger pro...
 Homo sapiens
EAW57250 0 99.7 zinc finger pro...
 Homo sapiens
AAF04106 0 99.7 zinc finger pro...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 219 241 PD000003 Zinc finger
IPR007087 247 270 PD000003 Zinc finger
IPR007087 275 298 PD000003 Zinc finger
IPR007087 303 326 PD000003 Zinc finger
IPR007087 387 410 PD000003 Zinc finger
IPR007087 415 438 PD000003 Zinc finger
IPR007087 471 494 PD000003 Zinc finger
IPR007087 499 522 PD000003 Zinc finger
IPR007087 527 550 PD000003 Zinc finger
IPR007087 555 578 PD000003 Zinc finger
IPR007087 583 606 PD000003 Zinc finger
IPR007087 611 634 PD000003 Zinc finger
IPR007087 639 662 PD000003 Zinc finger
IPR007087 695 717 PD000003 Zinc finger
HMMPfam IPR001909 51 91 PF01352 KRAB box
IPR007087 219 241 PF00096 Zinc finger
IPR007087 247 269 PF00096 Zinc finger
IPR007087 275 297 PF00096 Zinc finger
IPR007087 303 325 PF00096 Zinc finger
IPR007087 331 353 PF00096 Zinc finger
IPR007087 359 381 PF00096 Zinc finger
IPR007087 387 409 PF00096 Zinc finger
IPR007087 415 437 PF00096 Zinc finger
IPR007087 443 465 PF00096 Zinc finger
IPR007087 471 493 PF00096 Zinc finger
IPR007087 499 521 PF00096 Zinc finger
IPR007087 527 549 PF00096 Zinc finger
IPR007087 555 577 PF00096 Zinc finger
IPR007087 583 605 PF00096 Zinc finger
IPR007087 611 633 PF00096 Zinc finger
IPR007087 639 661 PF00096 Zinc finger
IPR007087 695 717 PF00096 Zinc finger
IPR007087 723 745 PF00096 Zinc finger
HMMSmart IPR001909 51 110 SM00349 KRAB box
IPR015880 219 241 SM00355 Zinc finger
IPR015880 247 269 SM00355 Zinc finger
IPR015880 275 297 SM00355 Zinc finger
IPR015880 303 325 SM00355 Zinc finger
IPR015880 331 353 SM00355 Zinc finger
IPR015880 359 381 SM00355 Zinc finger
IPR015880 387 409 SM00355 Zinc finger
IPR015880 415 437 SM00355 Zinc finger
IPR015880 443 465 SM00355 Zinc finger
IPR015880 471 493 SM00355 Zinc finger
IPR015880 499 521 SM00355 Zinc finger
IPR015880 527 549 SM00355 Zinc finger
IPR015880 555 577 SM00355 Zinc finger
IPR015880 583 605 SM00355 Zinc finger
IPR015880 611 633 SM00355 Zinc finger
IPR015880 639 661 SM00355 Zinc finger
IPR015880 695 717 SM00355 Zinc finger
IPR015880 723 745 SM00355 Zinc finger
ProfileScan IPR001909 51 121 PS50805 KRAB box
IPR007087 219 246 PS50157 Zinc finger
IPR007087 247 274 PS50157 Zinc finger
IPR007087 275 302 PS50157 Zinc finger
IPR007087 303 330 PS50157 Zinc finger
IPR007087 331 358 PS50157 Zinc finger
IPR007087 359 386 PS50157 Zinc finger
IPR007087 387 414 PS50157 Zinc finger
IPR007087 415 442 PS50157 Zinc finger
IPR007087 443 470 PS50157 Zinc finger
IPR007087 471 498 PS50157 Zinc finger
IPR007087 499 526 PS50157 Zinc finger
IPR007087 527 554 PS50157 Zinc finger
IPR007087 555 582 PS50157 Zinc finger
IPR007087 583 610 PS50157 Zinc finger
IPR007087 611 638 PS50157 Zinc finger
IPR007087 639 666 PS50157 Zinc finger
IPR007087 695 722 PS50157 Zinc finger
IPR007087 723 750 PS50157 Zinc finger
ScanRegExp IPR007087 221 241 PS00028 Zinc finger
IPR007087 249 269 PS00028 Zinc finger
IPR007087 277 297 PS00028 Zinc finger
IPR007087 305 325 PS00028 Zinc finger
IPR007087 333 353 PS00028 Zinc finger
IPR007087 361 381 PS00028 Zinc finger
IPR007087 389 409 PS00028 Zinc finger
IPR007087 417 437 PS00028 Zinc finger
IPR007087 445 465 PS00028 Zinc finger
IPR007087 473 493 PS00028 Zinc finger
IPR007087 501 521 PS00028 Zinc finger
IPR007087 529 549 PS00028 Zinc finger
IPR007087 557 577 PS00028 Zinc finger
IPR007087 585 605 PS00028 Zinc finger
IPR007087 613 633 PS00028 Zinc finger
IPR007087 641 661 PS00028 Zinc finger
IPR007087 697 717 PS00028 Zinc finger
IPR007087 725 745 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp