ORK01212

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01212

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01212
Clone name	hh11925
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PPFIBP2
cDNA sequence	DNA sequence (5521 bp) Predicted protein sequence (817 aa)
HaloTag ORF Clone	FHC01212
Flexi ORF Clone	FXC01212
Description	Liprin-beta-2 (Protein tyrosine phosphatase receptor type f polypeptide-interacting protein-binding protein 2) (PTPRF-interacting protein-binding protein 2).

Features of the cloned cDNA sequence

Description

Length: 5521 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2696 bp
Genome contig ID	gi51511727f_7455010
PolyA signal sequence (CATAAA,-28)	+--------+--------+----*----+---- GTTAGTTCATAAAACCTGCTGGAAAAAAAGTTCCG
Flanking genome sequence (179991 - 180040)	----+--------+--------+--------+--------+----* AAAAACTGTTTTGAATGTTCTGTAGAGACTGTGTTTTGTGAAATGGTCAC

Features of the protein sequence

Description

Length: 817 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10558	100.0	liprin-beta-2 [...	synthetic construct
EDM17959	88.5	protein tyrosin...	Rattus norvegicus
EDM17957	90.5	protein tyrosin...	Rattus norvegicus
AAB61902	88.5	coiled-coil lik...	Mus musculus
EDL16864	88.5	protein tyrosin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004191	122	186	PF02920	Integrase
	IPR001660	497	561	PF00536	Sterile alpha motif SAM
	IPR001660	572	632	PF00536	Sterile alpha motif SAM
	IPR011510	656	728	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001660	496	563	SM00454	Sterile alpha motif SAM
	IPR001660	568	634	SM00454	Sterile alpha motif SAM
	IPR001660	656	728	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	499	563	PS50105	Sterile alpha motif SAM
	IPR001660	576	634	PS50105	Sterile alpha motif SAM
	IPR001660	659	690	PS50105	Sterile alpha motif SAM

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp