ORK01214

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01214

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01214
Clone name	hg00295
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MYLK
cDNA sequence	DNA sequence (6205 bp) Predicted protein sequence (2020 aa)
HaloTag ORF Clone	FHC01214
Flexi ORF Clone	FXC01214
Description	Myosin light chain kinase, smooth muscle (EC 2.7.11.18) (MLCK) (Telokin) (Kinase-related protein) (KRP).

Features of the cloned cDNA sequence

Description

Length: 6205 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	60 bp
Genome contig ID	gi89161205r_124715582
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- TAAGTCATATTAAAAGGACTATTTCTCTAAAACTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAACTCAAGATAGTAAAAGCACCTAGTGTGATAGATT

Features of the protein sequence

Description

Length: 2020 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10561	100.0	myosin light ch...	synthetic construct
AAQ02673	99.9	long myosin lig...	Homo sapiens
NP_444253	99.8	myosin light ch...	Homo sapiens
Q15746	99.8	Myosin light ch...	Homo sapiens
AAR29062	99.7	myosin lignt ch...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR004829	1113	1167	PD153432	Cell surface antigen
BlastProDom	IPR000719	1571	1825	PD000001	Protein kinase
HMMPfam	IPR013098	140	230	PF07679	Immunoglobulin I-set
	IPR013098	268	357	PF07679	Immunoglobulin I-set
	IPR013098	521	611	PF07679	Immunoglobulin I-set
	IPR013098	621	707	PF07679	Immunoglobulin I-set
	IPR013098	730	819	PF07679	Immunoglobulin I-set
	IPR013098	828	918	PF07679	Immunoglobulin I-set
	IPR013098	1205	1294	PF07679	Immunoglobulin I-set
	IPR013098	1345	1434	PF07679	Immunoglobulin I-set
	IPR003961	1438	1523	PF00041	Fibronectin
	IPR000719	1571	1826	PF00069	Protein kinase
	IPR013098	1915	2005	PF07679	Immunoglobulin I-set
HMMSmart	IPR003599	146	231	SM00409	Immunoglobulin subtype
	IPR003598	152	220	SM00408	Immunoglobulin subtype 2
	IPR003599	274	358	SM00409	Immunoglobulin subtype
	IPR003598	280	347	SM00408	Immunoglobulin subtype 2
	IPR003599	527	612	SM00409	Immunoglobulin subtype
	IPR003598	533	601	SM00408	Immunoglobulin subtype 2
	IPR003599	627	708	SM00409	Immunoglobulin subtype
	IPR003598	633	697	SM00408	Immunoglobulin subtype 2
	IPR003599	736	820	SM00409	Immunoglobulin subtype
	IPR003598	742	809	SM00408	Immunoglobulin subtype 2
	IPR003599	834	919	SM00409	Immunoglobulin subtype
	IPR003598	840	908	SM00408	Immunoglobulin subtype 2
	IPR003599	1211	1295	SM00409	Immunoglobulin subtype
	IPR003598	1217	1284	SM00408	Immunoglobulin subtype 2
	IPR003599	1351	1435	SM00409	Immunoglobulin subtype
	IPR003598	1357	1424	SM00408	Immunoglobulin subtype 2
	IPR003961	1438	1520	SM00060	Fibronectin
	IPR001245	1571	1826	SM00219	Tyrosine protein kinase
	IPR002290	1571	1826	SM00220	Serine/threonine protein kinase
	IPR003599	1921	2006	SM00409	Immunoglobulin subtype
	IPR003598	1927	1995	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	140	229	PS50835	Immunoglobulin-like
	IPR007110	268	356	PS50835	Immunoglobulin-like
	IPR007110	521	610	PS50835	Immunoglobulin-like
	IPR007110	621	706	PS50835	Immunoglobulin-like
	IPR007110	727	818	PS50835	Immunoglobulin-like
	IPR007110	828	915	PS50835	Immunoglobulin-like
	IPR007110	1205	1293	PS50835	Immunoglobulin-like
	IPR007110	1345	1433	PS50835	Immunoglobulin-like
	IPR003961	1438	1529	PS50853	Fibronectin
	IPR000719	1571	1826	PS50011	Protein kinase
	IPR007110	1915	2004	PS50835	Immunoglobulin-like
ScanRegExp	IPR000719	1577	1600	PS00107	Protein kinase
ScanRegExp	IPR008271	1688	1700	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1749	TDMWSIGVICYILVSGLSPFMGD	1771	PRIMARY	23