Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01215
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB210004
Product ID ORK01215
Clone name fg02848
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol NCAN
cDNA sequence DNA sequence (6329 bp)
Predicted protein sequence (1335 aa)
Flexi ORF Clone FXC01215
Description Neurocan core protein precursor (Chondroitin sulfate proteoglycan 3).
Features of the cloned cDNA sequence

Length: 6329 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2320 bp
Genome contig ID gi42406306f_19088752
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
CTTCTTGGACATTTTAATAAATTTTTTAACAGTTC
Flanking genome sequence
(135290 - 135339)		 
----+----*----+----*----+----*----+----*----+----*
AACCTGCCCGTCACCACCTGATACCTTCATTCATTCATTCATTCAGCAAG

Features of the protein sequence

Length: 1335 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06086 0 100.0 CSPG3 variant p...
 Homo sapiens
O14594 0 100.0 Neurocan core p...
 Homo sapiens
AAC80576 0 99.7 neurocan [Homo ...
 Homo sapiens
Q5IS41 0 98.7 Neurocan core p...
 Pan troglodytes
AAV67378 0 93.8 chondroitin sul...
 Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000538 163 222 PD000918 Link
IPR000538 276 319 PD000918 Link
FPrintScan IPR000538 184 196 PR01265 Link
IPR000538 212 225 PR01265 Link
IPR000538 230 241 PR01265 Link
IPR000538 263 272 PR01265 Link
IPR002353 1101 1113 PR00356 Type II antifreeze protein
IPR002353 1113 1130 PR00356 Type II antifreeze protein
IPR002353 1131 1148 PR00356 Type II antifreeze protein
IPR002353 1158 1174 PR00356 Type II antifreeze protein
IPR002353 1209 1222 PR00356 Type II antifreeze protein
HMMPfam IPR000538 173 268 PF00193 Link
IPR000538 274 370 PF00193 Link
IPR006209 1026 1057 PF00008 EGF-like
IPR006209 1064 1095 PF00008 EGF-like
IPR001304 1119 1224 PF00059 C-type lectin
IPR000436 1229 1285 PF00084 Sushi/SCR/CCP
HMMSmart IPR003599 58 172 SM00409 Immunoglobulin subtype
IPR000538 172 269 SM00445 Link
IPR000538 273 371 SM00445 Link
IPR001881 1022 1058 SM00179 EGF-like calcium-binding
IPR006210 1025 1058 SM00181 EGF
IPR001881 1060 1096 SM00179 EGF-like calcium-binding
IPR006210 1063 1096 SM00181 EGF
IPR001304 1102 1223 SM00034 C-type lectin
IPR000436 1229 1285 SM00032 Sushi/SCR/CCP
ProfileScan IPR007110 69 167 PS50835 Immunoglobulin-like
IPR000538 174 269 PS50963 Link
IPR000538 273 371 PS50963 Link
IPR000742 1022 1058 PS50026 EGF-like
IPR000742 1060 1096 PS50026 EGF-like
IPR001304 1109 1223 PS50041 C-type lectin
IPR000436 1227 1287 PS50923 Sushi/SCR/CCP
ScanRegExp IPR000538 196 241 PS01241 Link
IPR000538 294 339 PS01241 Link
IPR013032 1046 1057 PS00022 EGF-like region
IPR013032 1046 1057 PS01186 EGF-like region
IPR001881 1060 1084 PS01187 EGF-like calcium-binding
IPR013032 1064 1075 PS00022 EGF-like region
IPR000152 1075 1086 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1084 1095 PS00022 EGF-like region
IPR001304 1198 1222 PS00615 C-type lectin

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 16 GAPFVWALGLLMLQMLLFVAGEQ 38 PRIMARY 23
2 58 SGSVQAALAELVALPCLFTLQPR 80 SECONDARY 23
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp