ORK01216

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01216

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01216
Clone name	fk04467
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SMARCA5
cDNA sequence	DNA sequence (3593 bp) Predicted protein sequence (1057 aa)
HaloTag ORF Clone	FHC01216
Flexi ORF Clone	FXC01216
Description	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 (EC 3.6.1.-) (SWI/SNF-related matrix- associated actin-dependent regulator of chromatin A5) (Sucrose nonfermenting protein 2 homolog) (hSNF2H).

Features of the cloned cDNA sequence

Description

Length: 3593 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	229 bp
Genome contig ID	gi89161207f_144554323
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TAACACTTGAAGTAATAAAATAGGCTTCATTTATT
Flanking genome sequence (139695 - 139744)	----+--------+--------+--------+--------+----* ACTAAGTGTTTCATTTGATTTATTTTTCTATTGTAGTTCCATTTGTGAAG

Features of the protein sequence

Description

Length: 1057 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60264	100.0	SWI/SNF-related...	Homo sapiens
NP_003592	99.9	SWI/SNF-related...	Homo sapiens
XP_001093597	99.8	similar to SWI/...	Macaca mulatta
XP_517459	99.9	SWI/SNF-related...	Pan troglodytes
XP_001502076	98.9	SWI/SNF related...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000330	188	468	PF00176	SNF2-related
	IPR001650	523	602	PF00271	DNA/RNA helicase
	IPR015194	748	846	PF09110	HAND
	IPR014778	847	888	PF00249	Myb
	IPR015195	902	1018	PF09111	SLIDE
HMMSmart	IPR014001	181	373	SM00487	DEAD-like helicases
	IPR001650	518	602	SM00490	DNA/RNA helicase
	IPR001005	846	895	SM00717	SANT
	IPR001005	948	1012	SM00717	SANT
ProfileScan	IPR014021	197	362	PS51192	Helicase
ProfileScan	IPR001650	492	643	PS51194	DNA/RNA helicase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp