Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01218
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01218
Clone name aj00539
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol HIRA
cDNA sequence DNA sequence (4346 bp)
Predicted protein sequence (1030 aa)
Flexi ORF Clone FXC01218
Description Protein HIRA (TUP1-like enhancer of split protein 1).
Features of the cloned cDNA sequence

Length: 4346 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1252 bp
Genome contig ID gi89161203r_17598099
PolyA signal sequence
(AATAAA,-17)		 
+----*----+----*----+----*----+----
TTGTGTAAGTTAATACTTAATAAACTTTCATATAT
Flanking genome sequence
(99612 - 99563)		 
----+----*----+----*----+----*----+----*----+----*
ATCTATTAGTTCTGTCCCTGTAGAGAACCCTAATATACCCCCCATGCAGA

Features of the protein sequence

Length: 1030 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10568 0 100.0 HIR histone cel...
 synthetic construct
P54198 0 99.9 Protein HIRA; T...
 Homo sapiens
XP_001165585 0 99.8 HIR (histone ce...
 Pan troglodytes
CAA61979 0 99.8 HIRA [Homo sapi...
 Homo sapiens
XP_001112873 0 99.2 similar to HIR ...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001680 82 110 PD000018 WD40 repeat
IPR001680 140 172 PD000018 WD40 repeat
IPR001680 182 214 PD000018 WD40 repeat
FPrintScan IPR001680 98 112 PR00320 WD40 repeat
IPR001680 159 173 PR00320 WD40 repeat
IPR001680 202 216 PR00320 WD40 repeat
HMMPfam IPR001680 73 111 PF00400 WD40 repeat
IPR001680 134 172 PF00400 WD40 repeat
IPR001680 177 215 PF00400 WD40 repeat
IPR001680 271 326 PF00400 WD40 repeat
IPR011494 776 975 PF07569 TUP1-like enhancer of split
HMMSmart IPR001680 14 57 SM00320 WD40 repeat
IPR001680 72 111 SM00320 WD40 repeat
IPR001680 133 172 SM00320 WD40 repeat
IPR001680 176 215 SM00320 WD40 repeat
IPR001680 225 267 SM00320 WD40 repeat
IPR001680 270 326 SM00320 WD40 repeat
IPR001680 332 369 SM00320 WD40 repeat
ProfileScan IPR001680 79 111 PS50082 WD40 repeat
IPR001680 79 224 PS50294 WD40 repeat
IPR001680 140 172 PS50082 WD40 repeat
IPR001680 183 214 PS50082 WD40 repeat
ScanRegExp IPR001680 159 173 PS00678 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp