Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01221
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01221
Clone name hh00253
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZXDB
cDNA sequence DNA sequence (5630 bp)
Predicted protein sequence (870 aa)
Flexi ORF Clone FXC01221
Description Zinc finger X-linked protein ZXDB.
Features of the cloned cDNA sequence

Length: 5630 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3015 bp
Genome contig ID gi89161218f_57535004
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TCTTGGAAATTAAATAAATTTATAAACATAAAGAT
Flanking genome sequence
(105631 - 105680)
----+----*----+----*----+----*----+----*----+----*
AATTTAATGCTGTGACTTCATTTTTTAAATTCTTTAAACCAACTTTCTCC

Features of the protein sequence

Length: 870 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P98169 0 100.0 Zinc finger X-l...
Homo sapiens
XP_001149537 0 97.9 zinc finger, X-...
Pan troglodytes
BAF85375 0 96.2 unnamed protein...
Homo sapiens
P98168 0 96.1 Zinc finger X-l...
Homo sapiens
ABZ92265 0 96.0 zinc finger, X-...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 338 362 PF00096 Zinc finger
IPR007087 371 395 PF00096 Zinc finger
IPR007087 401 425 PF00096 Zinc finger
IPR007087 431 453 PF00096 Zinc finger
IPR007087 460 484 PF00096 Zinc finger
IPR007087 491 515 PF00096 Zinc finger
IPR007087 521 545 PF00096 Zinc finger
IPR007087 551 575 PF00096 Zinc finger
IPR007087 614 639 PF00096 Zinc finger
HMMSmart IPR015880 338 362 SM00355 Zinc finger
IPR015880 371 395 SM00355 Zinc finger
IPR015880 401 425 SM00355 Zinc finger
IPR015880 431 453 SM00355 Zinc finger
IPR015880 460 484 SM00355 Zinc finger
IPR015880 491 515 SM00355 Zinc finger
IPR015880 521 545 SM00355 Zinc finger
IPR015880 551 575 SM00355 Zinc finger
IPR015880 581 605 SM00355 Zinc finger
IPR015880 614 639 SM00355 Zinc finger
ProfileScan IPR007087 338 367 PS50157 Zinc finger
IPR007087 371 400 PS50157 Zinc finger
IPR007087 401 430 PS50157 Zinc finger
IPR007087 431 458 PS50157 Zinc finger
IPR007087 460 489 PS50157 Zinc finger
IPR007087 491 520 PS50157 Zinc finger
IPR007087 521 550 PS50157 Zinc finger
IPR007087 551 580 PS50157 Zinc finger
IPR007087 581 610 PS50157 Zinc finger
ScanRegExp IPR007087 340 362 PS00028 Zinc finger
IPR007087 373 395 PS00028 Zinc finger
IPR007087 403 425 PS00028 Zinc finger
IPR007087 433 453 PS00028 Zinc finger
IPR007087 462 484 PS00028 Zinc finger
IPR007087 493 515 PS00028 Zinc finger
IPR007087 523 545 PS00028 Zinc finger
IPR007087 553 575 PS00028 Zinc finger
IPR007087 583 605 PS00028 Zinc finger
IPR007087 616 639 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp