ORK01228

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01228

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01228
Clone name	hk04515
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	BRPF1
cDNA sequence	DNA sequence (4514 bp) Predicted protein sequence (1224 aa)
HaloTag ORF Clone	FHC01228
Flexi ORF Clone	FXC01228
Description	Peregrin (Bromodomain and PHD finger-containing protein 1) (BR140 protein).

Features of the cloned cDNA sequence

Description

Length: 4514 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	524 bp
Genome contig ID	gi89161205f_9648488
PolyA signal sequence (None)	+--------+--------+----*----+---- TGCGTTTCCGGGTCGCGCCAGAGTCATTTGGTACT
Flanking genome sequence (116071 - 116120)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGACTGGGGGCTGTCCCCATTTCCCTTCTCTTT

Features of the protein sequence

Description

Length: 1224 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P55201	100.0	Peregrin; Bromo...	Homo sapiens
AAB02119	99.8	Br140 [Homo sap...	Homo sapiens
XP_001093928	99.8	similar to brom...	Macaca mulatta
CAD28495	99.9	hypothetical pr...	Homo sapiens
AAH53851	99.5	Bromodomain and...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	372	385	PR00503	Bromodomain
	IPR001487	672	688	PR00503	Bromodomain
	IPR001487	688	706	PR00503	Bromodomain
	IPR001487	706	725	PR00503	Bromodomain
HMMPfam	IPR001965	285	333	PF00628	Zinc finger
	IPR001487	643	730	PF00439	Bromodomain
	IPR000313	1092	1192	PF00855	PWWP
HMMSmart	IPR001965	285	331	SM00249	Zinc finger
	IPR001965	395	458	SM00249	Zinc finger
	IPR001487	636	744	SM00297	Bromodomain
	IPR000313	1093	1176	SM00293	PWWP
ProfileScan	IPR007087	31	62	PS50157	Zinc finger
	IPR001965	283	333	PS50016	Zinc finger
	IPR001487	655	725	PS50014	Bromodomain
	IPR000313	1095	1178	PS50812	PWWP
ScanRegExp	IPR007087	33	57	PS00028	Zinc finger
	IPR001965	286	330	PS01359	Zinc finger
	IPR001487	660	717	PS00633	Bromodomain

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp