ORK01229

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01229

Order Kazusa clone(s) from :

Accession No	AK226049
Product ID	ORK01229
Clone name	hk07106
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCDH12
cDNA sequence	DNA sequence (4274 bp) Predicted protein sequence (1195 aa)
HaloTag ORF Clone	FHC01229
Flexi ORF Clone	FXC01229
Description	Protocadherin-12 precursor (Vascular cadherin-2) (Vascular endothelial cadherin-2) (VE-cadherin-2) (VE-cad-2).

Features of the cloned cDNA sequence

Description

Length: 4274 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	411 bp
Genome contig ID	gi51511721r_141204719
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATGCTCTCTGACCTATCAATAAAGGAAAAGCAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCATTCTCCTGTTTGCACCTGTCAAGAGGGAGAAGGGAAGAGTAATAG

Features of the protein sequence

Description

Length: 1195 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAQ88794	100.0	PCDH12 [Homo sa...	Homo sapiens
BAG37515	99.9	unnamed protein...	Homo sapiens
Q9NPG4	99.9	Protocadherin-1...	Homo sapiens
EAW61898	99.8	protocadherin 1...	Homo sapiens
AAH52973	99.5	PCDH12 protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	86	105	PR00205	Cadherin
	IPR002126	255	284	PR00205	Cadherin
	IPR002126	328	340	PR00205	Cadherin
	IPR002126	450	469	PR00205	Cadherin
	IPR002126	469	482	PR00205	Cadherin
	IPR002126	524	550	PR00205	Cadherin
	IPR002126	558	575	PR00205	Cadherin
HMMPfam	IPR013164	41	125	PF08266	Cadherin
	IPR002126	151	246	PF00028	Cadherin
	IPR002126	260	354	PF00028	Cadherin
	IPR002126	370	462	PF00028	Cadherin
	IPR002126	476	567	PF00028	Cadherin
	IPR002126	629	669	PF00028	Cadherin
HMMSmart	IPR002126	47	144	SM00112	Cadherin
	IPR002126	168	253	SM00112	Cadherin
	IPR002126	277	361	SM00112	Cadherin
	IPR002126	387	469	SM00112	Cadherin
	IPR002126	493	574	SM00112	Cadherin
	IPR002126	632	715	SM00112	Cadherin
ProfileScan	IPR002126	39	146	PS50268	Cadherin
	IPR002126	147	255	PS50268	Cadherin
	IPR002126	256	363	PS50268	Cadherin
	IPR002126	366	471	PS50268	Cadherin
	IPR002126	472	576	PS50268	Cadherin
	IPR002126	629	722	PS50268	Cadherin
ScanRegExp	IPR002126	134	144	PS00232	Cadherin
	IPR002126	243	253	PS00232	Cadherin
	IPR002126	351	361	PS00232	Cadherin
	IPR002126	459	469	PS00232	Cadherin
	IPR002126	564	574	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	7	HLAVSMMQLLQLLLGLLGPGGYL	29	PRIMARY	23
SOSUI2	2	726	SMLTVICLAVLLGIFGLILALFM	748	PRIMARY	23